ID: 1149452549

View in Genome Browser
Species Human (GRCh38)
Location 17:56761101-56761123
Sequence GGGTGGCATCCACTGTGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149452549_1149452557 27 Left 1149452549 17:56761101-56761123 CCTAAACACAGTGGATGCCACCC No data
Right 1149452557 17:56761151-56761173 TGTCACTCACACAAGGTTCCAGG No data
1149452549_1149452556 20 Left 1149452549 17:56761101-56761123 CCTAAACACAGTGGATGCCACCC No data
Right 1149452556 17:56761144-56761166 GTGCTTTTGTCACTCACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149452549 Original CRISPR GGGTGGCATCCACTGTGTTT AGG (reversed) Intergenic
No off target data available for this crispr