ID: 1149453144

View in Genome Browser
Species Human (GRCh38)
Location 17:56765957-56765979
Sequence CGCCAAAGAGACCAACCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149453140_1149453144 28 Left 1149453140 17:56765906-56765928 CCAAGGAAGGTTACGGATTGGAA No data
Right 1149453144 17:56765957-56765979 CGCCAAAGAGACCAACCCCAGGG No data
1149453141_1149453144 -9 Left 1149453141 17:56765943-56765965 CCTCATCTAAACCTCGCCAAAGA No data
Right 1149453144 17:56765957-56765979 CGCCAAAGAGACCAACCCCAGGG No data
1149453137_1149453144 30 Left 1149453137 17:56765904-56765926 CCCCAAGGAAGGTTACGGATTGG No data
Right 1149453144 17:56765957-56765979 CGCCAAAGAGACCAACCCCAGGG No data
1149453139_1149453144 29 Left 1149453139 17:56765905-56765927 CCCAAGGAAGGTTACGGATTGGA No data
Right 1149453144 17:56765957-56765979 CGCCAAAGAGACCAACCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149453144 Original CRISPR CGCCAAAGAGACCAACCCCA GGG Intergenic