ID: 1149453173

View in Genome Browser
Species Human (GRCh38)
Location 17:56766099-56766121
Sequence CCTTTAAAGGCACATTTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149453173_1149453178 -2 Left 1149453173 17:56766099-56766121 CCTCTAAAATGTGCCTTTAAAGG No data
Right 1149453178 17:56766120-56766142 GGGAGCTCATTTGCCTTCATGGG No data
1149453173_1149453179 4 Left 1149453173 17:56766099-56766121 CCTCTAAAATGTGCCTTTAAAGG No data
Right 1149453179 17:56766126-56766148 TCATTTGCCTTCATGGGCCCCGG No data
1149453173_1149453180 5 Left 1149453173 17:56766099-56766121 CCTCTAAAATGTGCCTTTAAAGG No data
Right 1149453180 17:56766127-56766149 CATTTGCCTTCATGGGCCCCGGG No data
1149453173_1149453182 20 Left 1149453173 17:56766099-56766121 CCTCTAAAATGTGCCTTTAAAGG No data
Right 1149453182 17:56766142-56766164 GCCCCGGGAAAGCCTAAGATAGG No data
1149453173_1149453177 -3 Left 1149453173 17:56766099-56766121 CCTCTAAAATGTGCCTTTAAAGG No data
Right 1149453177 17:56766119-56766141 AGGGAGCTCATTTGCCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149453173 Original CRISPR CCTTTAAAGGCACATTTTAG AGG (reversed) Intergenic
No off target data available for this crispr