ID: 1149453176

View in Genome Browser
Species Human (GRCh38)
Location 17:56766112-56766134
Sequence GGCAAATGAGCTCCCTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149453176_1149453182 7 Left 1149453176 17:56766112-56766134 CCTTTAAAGGGAGCTCATTTGCC No data
Right 1149453182 17:56766142-56766164 GCCCCGGGAAAGCCTAAGATAGG No data
1149453176_1149453186 18 Left 1149453176 17:56766112-56766134 CCTTTAAAGGGAGCTCATTTGCC No data
Right 1149453186 17:56766153-56766175 GCCTAAGATAGGTGCCATCCAGG No data
1149453176_1149453179 -9 Left 1149453176 17:56766112-56766134 CCTTTAAAGGGAGCTCATTTGCC No data
Right 1149453179 17:56766126-56766148 TCATTTGCCTTCATGGGCCCCGG No data
1149453176_1149453180 -8 Left 1149453176 17:56766112-56766134 CCTTTAAAGGGAGCTCATTTGCC No data
Right 1149453180 17:56766127-56766149 CATTTGCCTTCATGGGCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149453176 Original CRISPR GGCAAATGAGCTCCCTTTAA AGG (reversed) Intergenic
No off target data available for this crispr