ID: 1149453178

View in Genome Browser
Species Human (GRCh38)
Location 17:56766120-56766142
Sequence GGGAGCTCATTTGCCTTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149453172_1149453178 23 Left 1149453172 17:56766074-56766096 CCATCAGACAGGAGAAGACAGAT No data
Right 1149453178 17:56766120-56766142 GGGAGCTCATTTGCCTTCATGGG No data
1149453173_1149453178 -2 Left 1149453173 17:56766099-56766121 CCTCTAAAATGTGCCTTTAAAGG No data
Right 1149453178 17:56766120-56766142 GGGAGCTCATTTGCCTTCATGGG No data
1149453171_1149453178 27 Left 1149453171 17:56766070-56766092 CCAGCCATCAGACAGGAGAAGAC No data
Right 1149453178 17:56766120-56766142 GGGAGCTCATTTGCCTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149453178 Original CRISPR GGGAGCTCATTTGCCTTCAT GGG Intergenic
No off target data available for this crispr