ID: 1149453179

View in Genome Browser
Species Human (GRCh38)
Location 17:56766126-56766148
Sequence TCATTTGCCTTCATGGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149453172_1149453179 29 Left 1149453172 17:56766074-56766096 CCATCAGACAGGAGAAGACAGAT No data
Right 1149453179 17:56766126-56766148 TCATTTGCCTTCATGGGCCCCGG No data
1149453173_1149453179 4 Left 1149453173 17:56766099-56766121 CCTCTAAAATGTGCCTTTAAAGG No data
Right 1149453179 17:56766126-56766148 TCATTTGCCTTCATGGGCCCCGG No data
1149453176_1149453179 -9 Left 1149453176 17:56766112-56766134 CCTTTAAAGGGAGCTCATTTGCC No data
Right 1149453179 17:56766126-56766148 TCATTTGCCTTCATGGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149453179 Original CRISPR TCATTTGCCTTCATGGGCCC CGG Intergenic
No off target data available for this crispr