ID: 1149453180

View in Genome Browser
Species Human (GRCh38)
Location 17:56766127-56766149
Sequence CATTTGCCTTCATGGGCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149453173_1149453180 5 Left 1149453173 17:56766099-56766121 CCTCTAAAATGTGCCTTTAAAGG No data
Right 1149453180 17:56766127-56766149 CATTTGCCTTCATGGGCCCCGGG No data
1149453172_1149453180 30 Left 1149453172 17:56766074-56766096 CCATCAGACAGGAGAAGACAGAT No data
Right 1149453180 17:56766127-56766149 CATTTGCCTTCATGGGCCCCGGG No data
1149453176_1149453180 -8 Left 1149453176 17:56766112-56766134 CCTTTAAAGGGAGCTCATTTGCC No data
Right 1149453180 17:56766127-56766149 CATTTGCCTTCATGGGCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149453180 Original CRISPR CATTTGCCTTCATGGGCCCC GGG Intergenic
No off target data available for this crispr