ID: 1149453181

View in Genome Browser
Species Human (GRCh38)
Location 17:56766133-56766155
Sequence GGCTTTCCCGGGGCCCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149453181_1149453192 25 Left 1149453181 17:56766133-56766155 CCTTCATGGGCCCCGGGAAAGCC No data
Right 1149453192 17:56766181-56766203 CAGACTCTTTAAGATCAACACGG No data
1149453181_1149453186 -3 Left 1149453181 17:56766133-56766155 CCTTCATGGGCCCCGGGAAAGCC No data
Right 1149453186 17:56766153-56766175 GCCTAAGATAGGTGCCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149453181 Original CRISPR GGCTTTCCCGGGGCCCATGA AGG (reversed) Intergenic
No off target data available for this crispr