ID: 1149453182

View in Genome Browser
Species Human (GRCh38)
Location 17:56766142-56766164
Sequence GCCCCGGGAAAGCCTAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149453173_1149453182 20 Left 1149453173 17:56766099-56766121 CCTCTAAAATGTGCCTTTAAAGG No data
Right 1149453182 17:56766142-56766164 GCCCCGGGAAAGCCTAAGATAGG No data
1149453176_1149453182 7 Left 1149453176 17:56766112-56766134 CCTTTAAAGGGAGCTCATTTGCC No data
Right 1149453182 17:56766142-56766164 GCCCCGGGAAAGCCTAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149453182 Original CRISPR GCCCCGGGAAAGCCTAAGAT AGG Intergenic
No off target data available for this crispr