ID: 1149453186

View in Genome Browser
Species Human (GRCh38)
Location 17:56766153-56766175
Sequence GCCTAAGATAGGTGCCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149453176_1149453186 18 Left 1149453176 17:56766112-56766134 CCTTTAAAGGGAGCTCATTTGCC No data
Right 1149453186 17:56766153-56766175 GCCTAAGATAGGTGCCATCCAGG No data
1149453181_1149453186 -3 Left 1149453181 17:56766133-56766155 CCTTCATGGGCCCCGGGAAAGCC No data
Right 1149453186 17:56766153-56766175 GCCTAAGATAGGTGCCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149453186 Original CRISPR GCCTAAGATAGGTGCCATCC AGG Intergenic
No off target data available for this crispr