ID: 1149457212

View in Genome Browser
Species Human (GRCh38)
Location 17:56797568-56797590
Sequence GCGTCCATACCAGGATGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149457212 Original CRISPR GCGTCCATACCAGGATGATG AGG Intronic
900478210 1:2886066-2886088 CCGTTCACACCAGGATGCTGAGG + Intergenic
901758351 1:11455059-11455081 GAGTCCATGTCAGAATGATGTGG - Intergenic
901784864 1:11617806-11617828 GCCTGCTTGCCAGGATGATGTGG - Intergenic
901867632 1:12117521-12117543 GCCTCCATTTCAGGGTGATGGGG - Intronic
911371826 1:97003315-97003337 CCTTCCATTCCAGGAGGATGTGG + Intergenic
921568751 1:216753026-216753048 AAGTTTATACCAGGATGATGAGG + Intronic
922852298 1:228743425-228743447 GCGTTCCAACTAGGATGATGGGG - Exonic
924867401 1:247999647-247999669 GATTCCATGCCAGGATGCTGTGG + Intronic
924868647 1:248015321-248015343 GATTCCATGCCAGGATGCTGTGG + Intronic
924871293 1:248048452-248048474 GATTCCATGCCAGGATGCTGTGG + Intronic
1065284200 10:24171669-24171691 TGGTGCATACCAGGAGGATGAGG + Intronic
1072031862 10:91529086-91529108 GCATCCAGCACAGGATGATGGGG + Intergenic
1089202371 11:116732119-116732141 CAGTCCAATCCAGGATGATGGGG + Intergenic
1101124237 12:101614578-101614600 GGGTCCATCCCAGCATGATTTGG + Intronic
1101540382 12:105659598-105659620 GCCTCCCTACCACAATGATGGGG - Intergenic
1102767567 12:115446876-115446898 GCGTCCCTACAAAGATAATGGGG - Intergenic
1111119061 13:83822667-83822689 GTGTCCATACAAGGTTGAAGAGG - Intergenic
1119296864 14:73539640-73539662 GCTTCCAGACCAGGAAGCTGCGG + Intronic
1119301096 14:73571554-73571576 GCTTCCAGACCAGGAAGCTGCGG + Intronic
1128399688 15:67265410-67265432 GCCTTCTTACCAGGAAGATGGGG + Intronic
1130121395 15:81050767-81050789 GCATCCATATCAGGGTGGTGGGG + Intronic
1132360177 15:101205990-101206012 ACTACCATACCAGGATCATGGGG - Intronic
1134341512 16:13351097-13351119 GCTTCCTCACCAGTATGATGGGG - Intergenic
1134894159 16:17869725-17869747 GCCTCCATCCCAGGCTAATGGGG + Intergenic
1135598139 16:23758860-23758882 GGGTGCATGCTAGGATGATGGGG + Exonic
1149457212 17:56797568-56797590 GCGTCCATACCAGGATGATGAGG + Intronic
1152385433 17:79971440-79971462 GCTTCCAGACCAGGATGACCTGG - Intronic
1160519069 18:79494214-79494236 CCGGCCACACCAGGTTGATGGGG - Intronic
1160519308 18:79494934-79494956 CCGGCCGTACCAGGTTGATGGGG - Intronic
1165735076 19:38170632-38170654 CCGTCCGTACCAGGACGGTGGGG - Intronic
1166496892 19:43309726-43309748 TGGTCCATACCTGGTTGATGAGG + Intergenic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
934543682 2:95196892-95196914 GCGTCAGCACCAGGATGAGGAGG + Intergenic
935383627 2:102478885-102478907 GCGCCCCCACCAGGATGAGGAGG - Exonic
938177279 2:129144941-129144963 GCTTGCATACCTGGAGGATGAGG - Intergenic
945316114 2:208372340-208372362 CCATCCATCCCAGGATGATGAGG - Intronic
1175387492 20:58606489-58606511 GGGTCCTTACCAGGAGGATAAGG + Intergenic
1176294758 21:5065541-5065563 GTGTCCCTACCAGTAGGATGAGG + Intergenic
1179862292 21:44196585-44196607 GTGTCCCTACCAGTAGGATGAGG - Intergenic
952594475 3:34999673-34999695 GCTTCTATTCCAGGAAGATGGGG + Intergenic
960759065 3:121052237-121052259 GCCTGGATGCCAGGATGATGCGG - Intronic
961537645 3:127579805-127579827 GCTTCCAGAGCAGGAAGATGAGG + Exonic
968944190 4:3654986-3655008 CCTTCCATTCCAGGATGGTGGGG + Intergenic
979408477 4:120343956-120343978 GCATCCCTACCAGGATGATGAGG + Intergenic
980098546 4:128518477-128518499 GAGTACATGGCAGGATGATGAGG + Intergenic
985477416 5:85977-85999 TGGTCCATCCCAGGATGCTGTGG - Intergenic
986200252 5:5572940-5572962 GTGTGAATACCAGGAAGATGTGG + Intergenic
995068081 5:107884746-107884768 GCGTCCTTACCTGGACAATGGGG + Intronic
995492609 5:112708207-112708229 GGGTCCAAACGAGGAAGATGGGG - Intronic
995513315 5:112929407-112929429 GATTCCATACCAGGATAATACGG + Intergenic
1001649996 5:173309521-173309543 AAGTCCCTGCCAGGATGATGGGG - Intergenic
1005771293 6:29075208-29075230 GCATCCCTACCACGGTGATGAGG - Intronic
1007406768 6:41639908-41639930 GCGTCCATACCAAGTAGGTGGGG - Intronic
1016411624 6:143789137-143789159 GCTTTCATACCTGGATGAGGAGG + Intronic
1017755580 6:157526430-157526452 ACTTCCATACCAGGATAATCTGG - Intronic
1019713441 7:2527726-2527748 GCGTCCAGGCCAGGAGGAAGGGG - Exonic
1024135784 7:46406626-46406648 GCAGCCAAACCATGATGATGGGG - Intergenic
1031450064 7:121905135-121905157 GATTCCATAGCAGGATGTTGAGG + Intronic
1041000622 8:53447063-53447085 GCTTACACACCAGGATCATGTGG + Intergenic
1042902460 8:73743311-73743333 GCCTACATCCCAAGATGATGAGG - Intronic
1043200798 8:77367156-77367178 GCGTTCGTATCAGGATGATGCGG - Intergenic
1055360468 9:75484481-75484503 CTGTCCATAGCAGGAGGATGAGG - Intergenic
1057457623 9:95228678-95228700 GGGTCTAGCCCAGGATGATGAGG + Intronic
1058220585 9:102295648-102295670 GTTTCCATATCAGGATGAGGAGG + Intergenic
1187043078 X:15617276-15617298 GGCTCAATACCAGGAGGATGAGG + Intergenic
1187742582 X:22372594-22372616 GTTTCCATAGAAGGATGATGGGG + Intergenic