ID: 1149460210

View in Genome Browser
Species Human (GRCh38)
Location 17:56822989-56823011
Sequence CAGGAACATGATGCTGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 205}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149460210_1149460217 21 Left 1149460210 17:56822989-56823011 CCAAGGTCAGCATCATGTTCCTG 0: 1
1: 0
2: 0
3: 23
4: 205
Right 1149460217 17:56823033-56823055 TCCAACTTAAACAGGGACAAAGG 0: 1
1: 0
2: 1
3: 32
4: 281
1149460210_1149460216 14 Left 1149460210 17:56822989-56823011 CCAAGGTCAGCATCATGTTCCTG 0: 1
1: 0
2: 0
3: 23
4: 205
Right 1149460216 17:56823026-56823048 GCTTCTCTCCAACTTAAACAGGG 0: 1
1: 0
2: 1
3: 8
4: 131
1149460210_1149460215 13 Left 1149460210 17:56822989-56823011 CCAAGGTCAGCATCATGTTCCTG 0: 1
1: 0
2: 0
3: 23
4: 205
Right 1149460215 17:56823025-56823047 GGCTTCTCTCCAACTTAAACAGG 0: 1
1: 0
2: 1
3: 7
4: 92
1149460210_1149460212 -8 Left 1149460210 17:56822989-56823011 CCAAGGTCAGCATCATGTTCCTG 0: 1
1: 0
2: 0
3: 23
4: 205
Right 1149460212 17:56823004-56823026 TGTTCCTGATGGCCAGTGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 170
1149460210_1149460219 29 Left 1149460210 17:56822989-56823011 CCAAGGTCAGCATCATGTTCCTG 0: 1
1: 0
2: 0
3: 23
4: 205
Right 1149460219 17:56823041-56823063 AAACAGGGACAAAGGAGCATTGG 0: 1
1: 0
2: 1
3: 25
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149460210 Original CRISPR CAGGAACATGATGCTGACCT TGG (reversed) Intronic
900607293 1:3529524-3529546 CAGGATCCTGCTGCTGCCCTCGG + Intronic
901425522 1:9180501-9180523 GATGAACAAGATGCTGCCCTTGG - Intergenic
901442275 1:9285669-9285691 CAGGAGCCTAATGCTAACCTTGG + Intergenic
901451202 1:9337974-9337996 CAGAGACAGGCTGCTGACCTTGG - Intronic
902080186 1:13815456-13815478 CAGGACAAAGATCCTGACCTTGG + Intronic
905502481 1:38450675-38450697 CAGGAACATGGTGCACAGCTGGG + Intergenic
905724276 1:40235789-40235811 CAGGCACAAGATGCTGGTCTTGG + Exonic
906298108 1:44661547-44661569 CAGGGACATGAGGCTGACTCTGG + Intronic
909699687 1:78509249-78509271 CAGGAATATGATGCTGACAATGG + Intronic
913243372 1:116850206-116850228 GGGAAACATAATGCTGACCTTGG - Intergenic
913669626 1:121084301-121084323 CAGGAATTTGAAACTGACCTGGG - Intergenic
914021384 1:143871700-143871722 CAGGAATTTGAAACTGACCTGGG - Intergenic
914347788 1:146814862-146814884 CAGGACTCTGATGCTTACCTAGG - Intergenic
918141369 1:181722930-181722952 CAGGAAAATGATGGTGCCATTGG - Intronic
919202485 1:194373857-194373879 CAGGAACATTAAGATCACCTGGG + Intergenic
919666699 1:200299690-200299712 TAGGAACATGATGGTCAGCTGGG - Intergenic
921106173 1:211981157-211981179 CTGGAACAAGATGCTGTCTTTGG - Exonic
921528239 1:216245169-216245191 CAGGAAGATTATGGAGACCTGGG - Intronic
921893697 1:220377906-220377928 CAGGACCAGGATGCTGGCCCAGG - Intergenic
922668625 1:227492667-227492689 CAGGAACTTGAGGCTGCCCTGGG - Intergenic
922819435 1:228473943-228473965 CAGCACCATGGTGCTGAGCTAGG - Intergenic
923165904 1:231361459-231361481 CAGGAACACGAACCTGATCTCGG + Intergenic
924036088 1:239939706-239939728 CAGGAACAAGTTGCTGACACAGG - Intergenic
924042342 1:239996581-239996603 CAGGAACAAGTTGCTGACACCGG + Intergenic
924243407 1:242060608-242060630 CATGAACTTGAGGCTGCCCTGGG + Intergenic
924813588 1:247424151-247424173 CAGGAAGATGATGTTGGACTGGG + Exonic
1063342063 10:5275271-5275293 CAGGAAGAAGCTGCTGTCCTGGG - Intergenic
1063529700 10:6819370-6819392 CATGAACAGGAGGCTGACCTGGG + Intergenic
1063798058 10:9535580-9535602 CAGAAACATGGTGCGGGCCTAGG + Intergenic
1064953512 10:20880870-20880892 CAGAAACATGATGCTGCCAAAGG - Exonic
1066456024 10:35573046-35573068 CAGGAACAGGATACTTAACTTGG + Intergenic
1067565737 10:47335562-47335584 CAGTAAAATGAAGCTGACCCTGG + Intergenic
1068119515 10:52771627-52771649 CAGGGACATGGTCCTCACCTTGG + Exonic
1069313040 10:67062908-67062930 CAGGAAATTGCTGCTGATCTTGG - Intronic
1069630743 10:69895633-69895655 CAGGGAGATGAGGCTGAGCTGGG - Intronic
1070167477 10:73909683-73909705 CAGGAAAATGCTGCAGGCCTAGG + Intronic
1070833401 10:79433700-79433722 CAGGAATAAGCTGCGGACCTTGG + Intronic
1075033094 10:119040238-119040260 GAGGAAAATGATGCTGACCCAGG + Intronic
1075285740 10:121184369-121184391 GAGAAACTTGATGCTTACCTCGG + Intergenic
1076380306 10:130020788-130020810 CAGGAACACGAGGCTGTCATCGG + Intergenic
1077759128 11:5071880-5071902 CAGGAACATGGTGCTAGCCTAGG - Intergenic
1077872253 11:6271765-6271787 TAGAAACATGACACTGACCTTGG + Exonic
1078071066 11:8110894-8110916 CAGGAACATGTTTCTGGCTTTGG + Exonic
1080051323 11:27861895-27861917 CAGTCACATGATGCTGACGAAGG + Intergenic
1080730099 11:34941825-34941847 CAGGACGATGATGCTGGCGTCGG + Intronic
1083014863 11:59443131-59443153 CAAGGACAAGATGCAGACCTGGG - Exonic
1083720110 11:64599723-64599745 CAGGAAGATGTTGCTGCCCAGGG - Exonic
1084141241 11:67231365-67231387 TAGAAACAGGATCCTGACCTAGG - Intronic
1084965942 11:72744612-72744634 CAGGACCATGACTCAGACCTTGG + Intronic
1085046033 11:73354252-73354274 CTGGACCTTGATGCTGACCATGG + Intronic
1085377489 11:76079063-76079085 AAAGAACATGGTGCTGACATGGG - Intronic
1088483746 11:110321100-110321122 CAGGAATTTGAGGCTGGCCTGGG - Intergenic
1091738669 12:2944143-2944165 CATGAACATGAAGCTGTCCAGGG - Intergenic
1096426483 12:51508045-51508067 CAGGAAGATGCCTCTGACCTGGG + Exonic
1097488432 12:60234946-60234968 CAGCAGCATGAAGTTGACCTGGG + Intergenic
1098468471 12:70816253-70816275 CAGGAAAATGATCCTTACCTAGG + Intronic
1099646485 12:85363893-85363915 CAGGAACATGATGTTGATTTTGG + Intergenic
1101478724 12:105076286-105076308 CAAGAACAAGATTCTGCCCTGGG + Intronic
1101870882 12:108564185-108564207 CAGGTTCAAGATGCTGACCGAGG + Intronic
1102524586 12:113502900-113502922 AAGGAACATGGTGTTGATCTGGG + Intergenic
1106061003 13:26291868-26291890 CAGAAAGATGATGGAGACCTAGG - Intronic
1106412294 13:29519031-29519053 CAGAAGCATTATGCTGAGCTGGG + Intronic
1107865915 13:44703179-44703201 CAGGAACATGCTACTGTACTTGG + Intergenic
1114530564 14:23392950-23392972 CAGGTCCATGATGCTCTCCTGGG + Exonic
1114535889 14:23422218-23422240 CAGGTCCATGATGCTCTCCTGGG + Exonic
1115297374 14:31844201-31844223 CAGGAAAAACATTCTGACCTTGG - Intronic
1118522805 14:66605620-66605642 CAGGAAAATGGTGTTAACCTGGG - Intronic
1121097572 14:91228562-91228584 CAGGGGCATGATGCAGCCCTGGG + Intergenic
1122198736 14:100109035-100109057 CAGGACCTCGATGCTGAGCTGGG - Intronic
1124030142 15:26003153-26003175 CAGGAAGATGATTCTGCCATAGG - Intergenic
1126049928 15:44676246-44676268 CAGTAATATGAGGCTGTCCTGGG + Intronic
1126969037 15:54088981-54089003 CAGAAACTTGATGCTGGCCTTGG + Intronic
1127775827 15:62263739-62263761 CAGAAACATGATGCTGACAATGG - Intergenic
1127875215 15:63106149-63106171 CAGGAACCAGATCCTGACCATGG - Intergenic
1128138341 15:65281002-65281024 CAGCAACATGAGCCTCACCTGGG - Intronic
1128554728 15:68623617-68623639 AAGGAACCTGAAGCTGCCCTTGG - Intronic
1131232911 15:90672498-90672520 CTTGAACATGACGCTGTCCTGGG + Intergenic
1131392987 15:92064156-92064178 GAGGCACCTGATGCTGAACTTGG + Intronic
1132722804 16:1325256-1325278 CAGAACCGAGATGCTGACCTGGG - Exonic
1135417568 16:22280297-22280319 CCGGTACATGATGCTGGCCAGGG + Exonic
1135509792 16:23072314-23072336 CTGGGAATTGATGCTGACCTCGG - Intronic
1135949577 16:26901529-26901551 CAGGAAAATGATGCGCAACTGGG + Intergenic
1136187304 16:28595915-28595937 CAGGAACATGGAGCTGATCCAGG - Exonic
1136189785 16:28608840-28608862 CAGGAACATGGAGCTGATCCAGG - Exonic
1136249057 16:28991801-28991823 CAGGGAAAGGATGGTGACCTTGG - Intergenic
1136317201 16:29461379-29461401 CAGGAACATGGAGCTGATCCAGG + Exonic
1136397515 16:30001245-30001267 CAGCAGCAGGATGCTGTCCTGGG - Intronic
1136431776 16:30200722-30200744 CAGGAACATGGAGCTGATCCAGG + Exonic
1138155160 16:54696242-54696264 CAGGAGGAGGAGGCTGACCTTGG - Intergenic
1139986250 16:70900670-70900692 CAGGACTCTGATGCTTACCTAGG + Intronic
1140730261 16:77849991-77850013 CAGGAACAGGAGCCTGACCTTGG - Intronic
1141161581 16:81632753-81632775 CAGGCACATGGTGCAAACCTAGG - Intronic
1141704315 16:85656283-85656305 CAGGAACAAGAGACGGACCTGGG - Intronic
1141788343 16:86216596-86216618 CTGGAAAAGGATGCTGACCTCGG + Intergenic
1142167839 16:88602365-88602387 CAGGGACATGGCCCTGACCTCGG - Intronic
1142382488 16:89741157-89741179 CAGGGAGATGATGCTGAGTTGGG - Intronic
1142467613 17:145211-145233 CAGGTGCATGATGGAGACCTGGG - Intergenic
1142485413 17:244554-244576 CAGGAAGAAGATGCTGGCCCCGG + Intronic
1142715481 17:1744989-1745011 CAGGAACATGGCGCTGCTCTGGG + Exonic
1144664763 17:17094818-17094840 CAGGAGCTTGAGGCTGGCCTGGG - Intronic
1146966641 17:37036988-37037010 CAAAAAGATGATGCTGTCCTGGG - Intronic
1147644116 17:42023649-42023671 AAGGACCACGATGGTGACCTGGG - Exonic
1147689029 17:42304283-42304305 CAGGACCATGCTCCTGGCCTGGG + Intronic
1147747809 17:42706168-42706190 CAGGGAAACGATTCTGACCTGGG + Exonic
1148131764 17:45266570-45266592 CTGGAACATGGTGCTGGCCCGGG - Exonic
1149045972 17:52246052-52246074 CAGAAACATGATGCTGTCATCGG - Intergenic
1149460210 17:56822989-56823011 CAGGAACATGATGCTGACCTTGG - Intronic
1149561458 17:57610738-57610760 AAGGAACATGCTGCTGCCCTAGG + Intronic
1150511589 17:65758103-65758125 CAGGTACATGACACTGCCCTTGG + Intronic
1151169162 17:72232251-72232273 CAGGAACCTTATGCTCTCCTGGG + Intergenic
1151685472 17:75643669-75643691 CAGAAAGATGCTGCAGACCTGGG + Intronic
1152507071 17:80756649-80756671 CAGCAACATGAAGCTAAACTGGG - Intronic
1156496441 18:37528825-37528847 GAGGAAAATGCTGCTGAACTAGG - Intronic
1159193335 18:65078441-65078463 CTGGAGCTTTATGCTGACCTTGG + Intergenic
1165599752 19:37044139-37044161 TAGGATCATGATTCTGCCCTGGG + Intronic
1166351063 19:42198501-42198523 CAGGAATTTGAGGCTGGCCTGGG + Intergenic
1166899093 19:46044480-46044502 CAGGAACTTGGTCCTGACCCAGG - Intronic
1167006401 19:46778881-46778903 CAGGAACATGATGCCCACAGGGG + Exonic
1167671089 19:50854185-50854207 CATGAGGATGATTCTGACCTGGG + Intergenic
925045001 2:766468-766490 CAGGACCATGGTGTTGGCCTTGG + Intergenic
925738500 2:6984826-6984848 AAGGAAAATGATCCTGGCCTTGG - Intronic
926700507 2:15800226-15800248 CGGGAGCAGTATGCTGACCTGGG - Intergenic
931792889 2:65681074-65681096 CTGGAAAATGAAGCTAACCTAGG - Intergenic
932174199 2:69584747-69584769 CAAAGACTTGATGCTGACCTGGG - Intronic
935202673 2:100871471-100871493 CAGGCACATGCTGCTGTGCTTGG + Intronic
935498239 2:103807492-103807514 CAGGAAAATGGTGTTGCCCTTGG - Intergenic
938231962 2:129669117-129669139 CAGGATGGTGATGCTGAGCTTGG - Intergenic
938941492 2:136173294-136173316 CAGGAACAAGATGGTCACCGTGG - Intergenic
939192232 2:138930531-138930553 CAGGAACATGATGCACATATGGG + Intergenic
939321829 2:140632968-140632990 CAGGAGAATGGTGCTAACCTGGG + Intronic
939515873 2:143167614-143167636 TAGGTACATGTTGGTGACCTTGG - Intronic
941837803 2:170045410-170045432 CAGCAACATGATCCAAACCTGGG - Intronic
944977455 2:205071373-205071395 CAGGAACAAGATGCACACCTAGG - Intronic
946280557 2:218662958-218662980 CATGAACACGATGCGGGCCTCGG - Exonic
946336236 2:219038521-219038543 CAAGGACATGATGCTCACCCAGG - Exonic
946961026 2:224986115-224986137 CTGACACATAATGCTGACCTTGG + Intronic
948455140 2:238101381-238101403 CAGGAACAGGATGCTGGGCCGGG - Intronic
948738944 2:240030388-240030410 CAGGATGAAGGTGCTGACCTTGG + Exonic
1168948208 20:1778699-1778721 CAGGAGCATGATCCAGACCCTGG - Intergenic
1170628867 20:18051096-18051118 CAGGCACATGCTGCTGAGCCTGG - Intronic
1172392492 20:34575333-34575355 GAGCTACATGATGCTCACCTTGG - Intronic
1173823183 20:46031513-46031535 AAGGAACTGGTTGCTGACCTCGG + Intronic
1173854924 20:46244135-46244157 CAGGGACATGATGGAGACCCAGG - Intronic
1174872354 20:54195009-54195031 TAGGAACATAATCCTGGCCTTGG - Intergenic
1175413654 20:58787406-58787428 CATGACCAGGATGCTGAGCTGGG + Intergenic
1177186570 21:17803942-17803964 CAGGAACTGGCTGCTGAACTGGG + Intronic
1178806115 21:35841021-35841043 CAGGAAGAAGATGCTGAATTAGG - Intronic
1180027650 21:45177039-45177061 AAGGAAAATGGTGCTGAACTGGG - Intronic
1183284540 22:36953708-36953730 CAGGAAAATGGTGCTGGCCTGGG - Intergenic
1184120536 22:42446862-42446884 CAGGAAAATGATGTGAACCTGGG + Intergenic
1184175147 22:42784820-42784842 CAGAATCATGATGCTGACACTGG + Intergenic
1185212988 22:49582281-49582303 GAGGAAGATGCTGCTGCCCTAGG + Intronic
950673072 3:14538846-14538868 CAGGCAGTTGATGCTGACCCTGG + Intronic
951087999 3:18537487-18537509 CAGGCACATGCTGCTGGGCTCGG + Intergenic
951698386 3:25469349-25469371 CATGAACATGATGCTGTCTTTGG + Intronic
952272205 3:31844090-31844112 TAGGTACAAGATGCTGAACTAGG + Intronic
952645136 3:35648181-35648203 AAGGAACATGATGCTTAACAAGG + Intronic
953198173 3:40753647-40753669 CACTAACATGATGCTGGCTTTGG + Intergenic
953883791 3:46704574-46704596 TAGGGACATGATCCTGCCCTGGG - Intronic
953944596 3:47135624-47135646 CAGGGATAGGATTCTGACCTAGG - Intronic
955582561 3:60440171-60440193 CAGGAACAACTTGCTGCCCTTGG + Intronic
961330614 3:126135880-126135902 CAGGAACAGGGTGGGGACCTTGG - Intronic
961500439 3:127329019-127329041 CAGGACCAGGATTCAGACCTAGG + Intergenic
963877167 3:150489361-150489383 CAGGAACATGAAGATGACGGGGG - Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
966038318 3:175447921-175447943 CAGGAACAAGATGCAGCCCAAGG - Intronic
968568820 4:1328784-1328806 CCGGCTCCTGATGCTGACCTGGG + Intronic
969313502 4:6367926-6367948 CATGAACAAGATTCTGAGCTGGG - Intronic
973291629 4:48476979-48477001 CAGGGAGTTGAGGCTGACCTTGG - Intergenic
975592069 4:76010816-76010838 CAGGGAAATGATGCTGGCCTGGG - Intergenic
977665513 4:99643055-99643077 CAGGTCCATGATGCTTACCCTGG + Intronic
979748217 4:124243673-124243695 CAGAAACTTGAGGCAGACCTGGG - Intergenic
980210174 4:129777135-129777157 CTGGAACATAATGCAGAACTCGG + Intergenic
983047483 4:163004587-163004609 CAGCAGCCTGATGTTGACCTGGG - Intergenic
984899290 4:184570413-184570435 TAGGGTCATGATGCTGCCCTGGG + Intergenic
987403506 5:17502133-17502155 CAGGACCAGGATGATGGCCTAGG + Intergenic
987779835 5:22419470-22419492 TAGGAACAAGATCATGACCTTGG - Intronic
989647823 5:43655091-43655113 CTGGAACATGAAGAAGACCTTGG - Intronic
989769820 5:45130383-45130405 CAGGAACATGATCATAACATAGG + Intergenic
991084130 5:62632987-62633009 CAGGAACATGGTGTGAACCTGGG - Intergenic
994422093 5:99534678-99534700 CTGGGACAGGATGCTGATCTCGG - Intergenic
995449077 5:112280659-112280681 GAGAAAGATGATGCTGACGTTGG + Intronic
996545283 5:124671612-124671634 CAGGCACATCATACTGTCCTGGG + Intronic
997114329 5:131109802-131109824 CAGGAACTTGATGCTGATGCTGG - Intergenic
1001870211 5:175147754-175147776 AAGGAAAATGATGCTGATCCAGG + Intergenic
1003300891 6:4882102-4882124 CAGGAACATGTTGGTACCCTGGG + Intronic
1005996443 6:30934269-30934291 TAGGAACAAGAGGATGACCTTGG + Intergenic
1006779375 6:36621758-36621780 CAGTATCATGATGCAAACCTGGG + Intergenic
1006985496 6:38172987-38173009 AAGCAGCATGCTGCTGACCTTGG - Exonic
1007041934 6:38730345-38730367 CAGGCACAAGATGCTGAGATAGG - Intronic
1008618797 6:53251717-53251739 CTGGAACCTGAGACTGACCTTGG + Intergenic
1009312831 6:62177044-62177066 CAAGCACATGATACTGACATAGG - Intronic
1013297338 6:108769303-108769325 CAGGAACAGGAACCTGACCTGGG + Intergenic
1016628104 6:146196378-146196400 CAGGAAAATGATGTGAACCTGGG - Intronic
1018306253 6:162459194-162459216 CAGTAATATGATGCTGCCTTTGG - Intronic
1018733291 6:166669224-166669246 CAGGAATATGAGGCAGAGCTGGG + Intronic
1019153064 6:170021901-170021923 CAGGAACAGGAAGCTGTCCCAGG + Intergenic
1020391415 7:7662177-7662199 CAGCAACCTGAAGCTGACCTGGG - Intronic
1022294992 7:29042460-29042482 CAGGAGCATGCTGCTGTGCTTGG - Intronic
1023107571 7:36777440-36777462 CAGGTATGTGATGCTGAGCTCGG - Intergenic
1028091358 7:86706706-86706728 CAGGCACATGATCTTGAACTAGG + Intronic
1030373921 7:108732691-108732713 CAGGGAAATGAGGCTGAACTTGG - Intergenic
1030680712 7:112430884-112430906 GGGGAACACGGTGCTGACCTAGG - Intronic
1030916129 7:115315761-115315783 CAGTAACATGAACATGACCTGGG - Intergenic
1031394726 7:121259323-121259345 CATGAACAGGAGGCTGATCTTGG + Intronic
1031857937 7:126944297-126944319 CAGGAATATGAGGTGGACCTGGG + Intronic
1033010071 7:137611966-137611988 CAGGAACATGCTATGGACCTAGG + Intronic
1036973104 8:13377163-13377185 CAGAAATAAGATGCTGCCCTTGG - Intronic
1037681834 8:21104056-21104078 CAGGAAAATGATGTGAACCTGGG + Intergenic
1038396837 8:27252497-27252519 CAGGAGCTTGAGGCTAACCTGGG - Intronic
1041167994 8:55110300-55110322 CAACAACATGATGGTGTCCTTGG + Intronic
1043648010 8:82547560-82547582 CAGGAATATGAGTCTGACTTAGG + Intergenic
1043982769 8:86659993-86660015 CAGAATCATGATGCTGACATTGG - Intronic
1044021455 8:87110613-87110635 CCGGAGCATGTTGCTGACCAAGG + Intronic
1046505412 8:115130906-115130928 CAGGAACAAGCTTCAGACCTGGG + Intergenic
1046689246 8:117264160-117264182 CTGGAAGACAATGCTGACCTAGG - Intergenic
1051777178 9:20647865-20647887 CATTAACATGATGCTGGCTTTGG - Intergenic
1052047369 9:23810323-23810345 CAGGGCCAGGATTCTGACCTTGG - Intronic
1056106931 9:83356011-83356033 CAGCAAAATGATGCTACCCTGGG - Intronic
1057905951 9:98983618-98983640 CAGGAAAGTGAGGCTGACATGGG - Intronic
1060589626 9:124808631-124808653 CAGGAAGGTGATGCTGAGCTGGG + Intronic
1061486558 9:130923401-130923423 CAGGAACCTGTTGCTAACGTGGG - Intronic
1061543024 9:131288537-131288559 CAAGAACAGGAAGCTGCCCTGGG - Intergenic
1062161040 9:135080036-135080058 CAGGGAGGTGATGCTGACTTAGG + Intronic
1185874059 X:3687854-3687876 GAGGAACACGATGCTGTCCTTGG - Intronic
1187797505 X:23020416-23020438 CAGGGACAAGATAATGACCTTGG + Intergenic
1187833498 X:23406903-23406925 CAGGAACTTGAGGCTAGCCTGGG - Intergenic
1190791640 X:53706126-53706148 CAGGAAGAAAATGGTGACCTTGG + Intergenic
1201706508 Y:16943448-16943470 TAGGACCATGATGCCCACCTGGG + Intergenic