ID: 1149461938

View in Genome Browser
Species Human (GRCh38)
Location 17:56835288-56835310
Sequence CAGAATGCGCCGTGGGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149461930_1149461938 25 Left 1149461930 17:56835240-56835262 CCCAAGCTTTGCGATTACAGGTA 0: 1
1: 3
2: 120
3: 2252
4: 33649
Right 1149461938 17:56835288-56835310 CAGAATGCGCCGTGGGAATCAGG 0: 1
1: 0
2: 0
3: 7
4: 56
1149461931_1149461938 24 Left 1149461931 17:56835241-56835263 CCAAGCTTTGCGATTACAGGTAT 0: 1
1: 0
2: 4
3: 62
4: 822
Right 1149461938 17:56835288-56835310 CAGAATGCGCCGTGGGAATCAGG 0: 1
1: 0
2: 0
3: 7
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149461938 Original CRISPR CAGAATGCGCCGTGGGAATC AGG Intronic
920305413 1:205015311-205015333 CAGGATGAGCAGTGGGAGTCTGG - Intronic
923805991 1:237258418-237258440 CAGGATGCTGCCTGGGAATCTGG + Intronic
1064527404 10:16271836-16271858 CACAATGCTCCTTGAGAATCTGG + Intergenic
1067223439 10:44360381-44360403 CAGTGTGCGCTGTGGGAGTCAGG - Intergenic
1071078448 10:81782275-81782297 CAGAAGGGGCTGTGGGAAGCAGG - Intergenic
1080855886 11:36111253-36111275 CAGGATGAGCCTGGGGAATCGGG + Intronic
1100385539 12:94101958-94101980 CTGAATGCGGCCTGGGCATCTGG + Intergenic
1102150273 12:110684862-110684884 CAGAAGGCGACGTAGGAAACTGG - Intronic
1103280730 12:119756178-119756200 CAGACTGGGCCATGGGGATCTGG - Intronic
1104876089 12:132035838-132035860 CACAATGCCCCGTGTGAACCTGG - Intronic
1104876134 12:132036112-132036134 CACAATGCTCCGTGTGAACCCGG - Intronic
1109589100 13:64453497-64453519 CAAAATGCTCTGTGGGCATCTGG + Intergenic
1115087128 14:29531180-29531202 CAGAATGGGCCATGGTTATCTGG - Intergenic
1117823449 14:59675354-59675376 CAGAATGCTCAGTAGGAAGCTGG + Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1129737336 15:77973675-77973697 CAGAATCCACTGTGAGAATCAGG - Intergenic
1129848736 15:78779950-78779972 CAGAATCCACTGTGAGAATCAGG + Intronic
1130009856 15:80142624-80142646 CAGAGTGCAGAGTGGGAATCAGG + Intergenic
1132022035 15:98371120-98371142 CAGAATGGGCAGTGGGAATGAGG - Intergenic
1132162495 15:99556108-99556130 CAGCAGGGGCCGTGGGAATCAGG + Intergenic
1133275370 16:4635012-4635034 CAGAAGGCTCCCTGGGAGTCTGG - Intronic
1133953369 16:10418013-10418035 TAGAGTGCGGAGTGGGAATCAGG + Intronic
1134910474 16:18021572-18021594 TAGAATTCCCCATGGGAATCAGG - Intergenic
1143216310 17:5227746-5227768 AAGAAAGCGCCATGGGAATGGGG - Intronic
1147420030 17:40318048-40318070 AAGACTGGACCGTGGGAATCCGG - Intronic
1149461938 17:56835288-56835310 CAGAATGCGCCGTGGGAATCAGG + Intronic
1151806814 17:76410782-76410804 CAGCATGTGCCTTGGGAGTCAGG - Intronic
1152778483 17:82216195-82216217 TAGAATGCGGCTTGGGAATAGGG - Intergenic
1159726187 18:71962782-71962804 CACAATGCTCTGTGGGAATCAGG + Intergenic
1161457726 19:4377941-4377963 CAGAAGGGGCCCTGGGAAGCAGG - Intronic
1164230755 19:23285716-23285738 CAGAGTGCAGAGTGGGAATCAGG - Intergenic
1166612052 19:44207430-44207452 CAGAATGCCCCAGGGGAAACCGG - Intergenic
1168398540 19:56068921-56068943 CAGAATTGGCCGTGGGGCTCAGG - Intergenic
943677901 2:190734645-190734667 CAGAATGCACCTGGGCAATCTGG - Intergenic
946812148 2:223537215-223537237 CAGCATGGGCTATGGGAATCAGG - Intergenic
1171010510 20:21506764-21506786 TATAATGCGCCGGGGGGATCAGG + Intergenic
1173791984 20:45833916-45833938 CTGAATGCACCGTGGGACGCAGG + Exonic
1174708039 20:52676904-52676926 CACAATCAGCCGTGGGAATGTGG - Intergenic
1181807592 22:25384395-25384417 CAGCCAGCGCCGTGGGAGTCGGG + Intronic
1183255854 22:36761705-36761727 CAGAACTCGCCGTGGGAACCTGG - Intronic
1184263384 22:43332630-43332652 CAGAATTCGCCTGGGGAAACTGG - Intronic
1184811195 22:46833466-46833488 AAGAATGTGCCGTGGGACTCAGG - Intronic
949779383 3:7668927-7668949 CAGAATACACTGTGGGAATCAGG - Intronic
965315363 3:167183496-167183518 TAGAGTGCGGAGTGGGAATCAGG + Intergenic
966511357 3:180766753-180766775 CAGAGTGCAGAGTGGGAATCAGG - Intronic
967242620 3:187456013-187456035 CAGAATGAGACGTGGGGATGTGG + Intergenic
980667735 4:135960618-135960640 TAGAGTGCGGAGTGGGAATCAGG + Intergenic
989187894 5:38642732-38642754 CAGAATAAGCCCTGGGAAGCAGG - Intergenic
1003970836 6:11297559-11297581 GAGAATGAGCCTTGGGAATCTGG - Intronic
1009345334 6:62607793-62607815 CAGAATGGGCATTGGGATTCTGG + Intergenic
1014561428 6:122895821-122895843 CAGAATGCGGGGTGGGCCTCAGG - Intergenic
1017279002 6:152603305-152603327 CAGAATATGGCGTGGAAATCAGG - Intronic
1018364673 6:163107490-163107512 CAGTGTGCGCCGTGTGACTCAGG - Intronic
1031981644 7:128130805-128130827 GAGAATGGGCCGTGGGAAAGTGG + Intergenic
1032616496 7:133478007-133478029 CAGAATGCCCAGATGGAATCAGG + Intronic
1036697524 8:10987595-10987617 CAGAATACACTGTGGGAATGTGG - Intronic
1045510216 8:102807439-102807461 CACAAGGCGCCGTGGCACTCAGG + Intergenic
1052183037 9:25554274-25554296 CAGGATGCTCAGTTGGAATCTGG - Intergenic
1060296764 9:122348355-122348377 CAGAATGCTCCCTAGGAACCTGG + Intergenic
1186587193 X:10887902-10887924 CAGAATCAGCCCTGGGGATCAGG - Intergenic
1190158193 X:48010518-48010540 CAGGAAGCTCAGTGGGAATCAGG + Intronic
1190173964 X:48133400-48133422 CAGGAAGCTCAGTGGGAATCAGG + Intergenic
1194689339 X:96963567-96963589 CAGAGTTCACAGTGGGAATCTGG + Intronic
1195658157 X:107352943-107352965 CAGAATGCTCCGTGAGAGGCAGG - Intergenic