ID: 1149467882

View in Genome Browser
Species Human (GRCh38)
Location 17:56893855-56893877
Sequence ACTCCGTGTCACAAAATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149467882_1149467889 10 Left 1149467882 17:56893855-56893877 CCCTGGATTTTGTGACACGGAGT 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1149467889 17:56893888-56893910 CCTCAGAGCTGCCTGGGTCAAGG 0: 1
1: 0
2: 2
3: 47
4: 353
1149467882_1149467890 11 Left 1149467882 17:56893855-56893877 CCCTGGATTTTGTGACACGGAGT 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1149467890 17:56893889-56893911 CTCAGAGCTGCCTGGGTCAAGGG 0: 1
1: 0
2: 3
3: 31
4: 313
1149467882_1149467893 22 Left 1149467882 17:56893855-56893877 CCCTGGATTTTGTGACACGGAGT 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1149467893 17:56893900-56893922 CTGGGTCAAGGGCAGGACAGAGG 0: 1
1: 0
2: 5
3: 42
4: 449
1149467882_1149467886 3 Left 1149467882 17:56893855-56893877 CCCTGGATTTTGTGACACGGAGT 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1149467886 17:56893881-56893903 CTGATGACCTCAGAGCTGCCTGG 0: 1
1: 0
2: 1
3: 28
4: 340
1149467882_1149467891 15 Left 1149467882 17:56893855-56893877 CCCTGGATTTTGTGACACGGAGT 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1149467891 17:56893893-56893915 GAGCTGCCTGGGTCAAGGGCAGG 0: 1
1: 0
2: 1
3: 51
4: 382
1149467882_1149467887 4 Left 1149467882 17:56893855-56893877 CCCTGGATTTTGTGACACGGAGT 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1149467887 17:56893882-56893904 TGATGACCTCAGAGCTGCCTGGG 0: 1
1: 0
2: 4
3: 20
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149467882 Original CRISPR ACTCCGTGTCACAAAATCCA GGG (reversed) Intronic
902630393 1:17701314-17701336 CCTCCGTGTGGCTAAATCCAAGG - Intergenic
905167707 1:36092622-36092644 ACTCCGTGTCACAGCAGCCCAGG - Intronic
905526554 1:38644478-38644500 ACTCCTTGTCAGAGCATCCAAGG + Intergenic
905574507 1:39033025-39033047 TTTCTGTGTCACAGAATCCAGGG + Intronic
905943996 1:41886460-41886482 CCTCGGTGTCACAAAATGCTGGG - Intronic
909696562 1:78474107-78474129 CCTCAGGGTCACAAAATGCAGGG - Intronic
910578395 1:88793660-88793682 TCTCCCTGTACCAAAATCCATGG + Intronic
914998434 1:152565180-152565202 ACTCAGTGACTGAAAATCCAGGG - Intronic
915147974 1:153806564-153806586 ACACAGTTTCACAATATCCATGG + Exonic
922348255 1:224715140-224715162 ACTCAGCGTCACCAAATCCAGGG + Intronic
923157585 1:231292197-231292219 GCTTCATGTCACAAAATCGAGGG + Intergenic
1070096037 10:73339269-73339291 ACTCCCTTTCACAATTTCCAAGG + Intronic
1070703067 10:78617494-78617516 ACTGCGTGTCCCCAAATTCATGG - Intergenic
1074063402 10:109989596-109989618 ACTCCGTGTCAAAAAAAAAACGG - Intergenic
1083182171 11:60994035-60994057 CCTCTCTGTCACCAAATCCAAGG - Intronic
1087266011 11:96062167-96062189 ACTCCATGTAACACAAACCAAGG - Intronic
1092892683 12:12983680-12983702 ACTCCGTGTTAAAAATTCCATGG + Intronic
1094494406 12:30980480-30980502 TGTCCGTGTCAGAAAATTCAAGG + Intronic
1096177204 12:49530155-49530177 ACTCCGTCTCACAAAAAAAAAGG + Intergenic
1097015607 12:55984485-55984507 ACTCCGTCTCAAAAAATAAAAGG - Intronic
1097708076 12:62888638-62888660 CTTCCGTGTTACAAAATACAGGG - Intronic
1097846447 12:64371523-64371545 ACTCCTTATAAGAAAATCCAGGG + Intronic
1098227808 12:68342791-68342813 ACTCCATCTCACAAAGTCTAGGG - Intergenic
1099918162 12:88922200-88922222 ACTACTTGTCACAAATTCTAGGG + Intergenic
1106250604 13:27979035-27979057 ACTTAGGGTCACAAAATCCAGGG - Intronic
1106597319 13:31156629-31156651 ACTCTGTGCCAGAAAATGCATGG + Intronic
1109353907 13:61217055-61217077 ACCCCTGGTCACAATATCCAAGG + Intergenic
1109765437 13:66889611-66889633 ACTCCTTGTCACTTACTCCATGG + Intronic
1111909023 13:94289581-94289603 ACACTGTGCCACAAATTCCATGG - Intronic
1112909395 13:104463019-104463041 ACTCCATGTCCCCACATCCAGGG + Intergenic
1118658898 14:67985584-67985606 TGTCCGTGTCACAAAAGTCAAGG - Intronic
1119819016 14:77597764-77597786 ACTCCGTGTCAAAAAAAAAAAGG + Intronic
1121966957 14:98318140-98318162 CCTCAGTGTCACAAAATGCTGGG + Intergenic
1121986997 14:98516655-98516677 ACTCCGTGTCAGAATCCCCAGGG - Intergenic
1122487687 14:102092319-102092341 CCTCGGTGTCGCAAAATCCTGGG + Intronic
1123025968 14:105424200-105424222 ACTCCGTCTCAAAAAAACAAAGG - Intronic
1130009350 15:80136454-80136476 ACTCCGTGTCAAAAAAAAAAAGG + Intronic
1132039780 15:98515457-98515479 AGTGCGTGTCACAAAGCCCAAGG - Intergenic
1133445758 16:5859618-5859640 CCTCCCTGTCACAAAACCCTGGG - Intergenic
1133603751 16:7366010-7366032 ACTCTGTGTCAGAAACTCCCAGG + Intronic
1137025056 16:35465717-35465739 ATTCTGTGTCAAAAACTCCAAGG - Intergenic
1137528572 16:49261242-49261264 ACTTCCTGTCACCAACTCCAAGG + Intergenic
1141300659 16:82812588-82812610 CCTCCGTGTCACTAGATGCAGGG - Intronic
1144782773 17:17816201-17816223 ACTCACTGTCAGAAAATGCAAGG + Exonic
1147155328 17:38541940-38541962 ACTCCGTCTCAAAAAATAGAGGG + Intronic
1149298848 17:55285773-55285795 ACTCCTTGGCAGAACATCCACGG + Intronic
1149467882 17:56893855-56893877 ACTCCGTGTCACAAAATCCAGGG - Intronic
1155222279 18:23696506-23696528 ACTCCGTCTCAAAAAAAACAGGG - Intronic
1159851890 18:73534790-73534812 CCTCAGTGTCACCAAGTCCAGGG - Intergenic
1161328580 19:3675504-3675526 ACTGCGTTTCACAAAAGCCTTGG - Intronic
1162231107 19:9267826-9267848 ACCCCGTGTCACAGAGTTCAGGG + Intergenic
1162306966 19:9880903-9880925 ACTCTGTCTCAGAAAATCCTTGG - Intronic
1162603941 19:11692961-11692983 AATCAGAGTCACAAAATGCAGGG + Intergenic
1162776264 19:12981485-12981507 ACTCCGTCTCACAAAAAAAAAGG - Intergenic
1164785511 19:30927355-30927377 ACTTCCTGCCACTAAATCCAAGG + Intergenic
1167497752 19:49829527-49829549 ACTCGGTCTCACAAAATCCTGGG + Intronic
927522054 2:23704757-23704779 ACTCCGTCTCACAAAAAAGAAGG + Intronic
927889514 2:26739531-26739553 ACTCCGTCTCACAAAAAAGAGGG + Intergenic
929282298 2:40093691-40093713 ACTACGTGTCACTAAAAACAAGG - Intergenic
929926266 2:46213824-46213846 ACACAGTGTACCAAAATCCATGG - Intergenic
930279913 2:49357856-49357878 TCTCCATGTCACTGAATCCAGGG - Intergenic
930652016 2:53972301-53972323 ACTCCGTCTCAAAAAATAAAAGG + Intronic
932507443 2:72249265-72249287 ACTCCGTCTCAAAAAATAAAAGG - Intronic
935434643 2:103016349-103016371 ACTCAGTGTCACATAATTAAGGG - Intergenic
936688744 2:114860355-114860377 ACTCCGTAACATAAACTCCATGG + Intronic
1170083291 20:12500657-12500679 ACTCAGACTCCCAAAATCCAAGG - Intergenic
1170742178 20:19067712-19067734 GCTCTGTGTCAGAATATCCAAGG - Intergenic
1171254135 20:23673782-23673804 ACTCCGTTTTACAAAAAGCATGG - Intergenic
1175047540 20:56121346-56121368 CCTCTGTGTTACAAAATCAAGGG - Intergenic
952516837 3:34113029-34113051 ACTTTGTGTCACAGAAGCCAAGG - Intergenic
953926083 3:46983069-46983091 ACTCAGGGTCACAAAGTTCAGGG + Intronic
956619608 3:71208172-71208194 ACACAGTAACACAAAATCCAAGG + Intronic
956726427 3:72160354-72160376 ACTCAGTGCCACAAAGACCAGGG - Intergenic
958541406 3:95479409-95479431 ACTCCTTGTCAAGAAATGCAAGG + Intergenic
961205804 3:125080627-125080649 ACTCTTTGTCACACAATCCAGGG + Intergenic
965307290 3:167082425-167082447 TCTCCTTGTTACTAAATCCAGGG + Intergenic
968014785 3:195319528-195319550 ACTCCATGTCTCACATTCCAGGG - Intronic
970306373 4:14736413-14736435 ACTCCATGTCACAAAACCCTGGG + Intergenic
971887304 4:32468487-32468509 ACTTCGTGACACAGAATTCAAGG - Intergenic
975826093 4:78320851-78320873 CCTGTGTGTCACAAAAGCCAGGG - Intronic
977816832 4:101424718-101424740 ACTCCGTCTCAAAAAAACAAGGG - Intronic
978318913 4:107471778-107471800 TCTCGGAGTCACAAAATGCAAGG + Intergenic
980837034 4:138207698-138207720 ACTCCGTCTCAAAAAATAAAAGG + Intronic
982612306 4:157590799-157590821 ACTCTGAGCCACAAAACCCAAGG - Intergenic
987590018 5:19912369-19912391 CCTCTGTGTCACTAAATCCATGG - Intronic
989055336 5:37360839-37360861 ACTCCGTCTCCCAAAAAACAGGG + Intronic
989702101 5:44280920-44280942 ACTCTGTTTCACAAATACCAAGG - Intergenic
990674783 5:58171668-58171690 ACTCCGTCTCAAAAAATAAAAGG - Intergenic
994010554 5:94897362-94897384 ACTCTGTCTCAAAAAGTCCAGGG - Intronic
994051461 5:95366598-95366620 ACTTCTTGACACAAAATTCAAGG + Intergenic
994103091 5:95915618-95915640 ACACAGTGTGACAAATTCCAGGG + Intronic
995376306 5:111478011-111478033 AATACCTGTCAAAAAATCCATGG + Intronic
998954584 5:147426151-147426173 ATTACGTGTCACAAAATACAGGG + Intronic
999811120 5:155128205-155128227 ACTCAGAGTCACAAAAGCCTGGG - Intergenic
1000209190 5:159095568-159095590 GCTCTATGTCACAAAATTCAGGG - Intronic
1000312966 5:160062745-160062767 ACTCCATATCACAAGAGCCAAGG + Intronic
1007782597 6:44263109-44263131 ACTCAGTGTTACACATTCCAAGG + Intronic
1010247500 6:73675220-73675242 CCTCAGTGTCCCAAAATGCAGGG + Intergenic
1014409648 6:121098595-121098617 ACACTGTGTCAGAAAATCAAGGG + Intronic
1018721174 6:166573607-166573629 AGTCAGTGTGACAAAACCCATGG - Intronic
1020011124 7:4806376-4806398 ACTCCTGGTCTCAAACTCCACGG + Intronic
1020443751 7:8246752-8246774 ACTCCGTCTCAAAAAATAAAAGG - Intronic
1023961074 7:44926824-44926846 ACTCCTTTTCTCAAAAGCCAAGG - Intergenic
1025182871 7:56832519-56832541 AGTCCAGGCCACAAAATCCAGGG - Intergenic
1025689055 7:63744455-63744477 AGTCCAGGCCACAAAATCCAGGG + Intergenic
1027260868 7:76463548-76463570 ACTCAGCGACACAAATTCCAAGG - Exonic
1027312246 7:76961660-76961682 ACTCAGCGACACAAATTCCAAGG - Intergenic
1031372753 7:120987786-120987808 GCTCCGTCTCTCAAAATACAAGG + Intergenic
1033444441 7:141408065-141408087 TCTCAGTGTCAGAAAATGCAGGG - Intronic
1037160142 8:15759675-15759697 ATGCCATGTTACAAAATCCAGGG - Intronic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1038921953 8:32094378-32094400 ACTGCATGTCACAAAAGCCTGGG - Intronic
1039759932 8:40563745-40563767 ACCCTCTGTCACAAAATTCATGG - Intronic
1043535178 8:81195149-81195171 ACTCAGTTTCACAAAATGTAAGG + Intergenic
1044447737 8:92298214-92298236 ACTCAGGGTCATTAAATCCAGGG - Intergenic
1045948849 8:107829169-107829191 AGTTCCTGTCACCAAATCCATGG - Intergenic
1051119597 9:13737516-13737538 ACTCTGTCTCACAAAAGCGAAGG - Intergenic
1051485711 9:17605728-17605750 ACTGCATGTCATAAAATTCATGG + Intronic
1056159468 9:83874042-83874064 ACTCCGTGTCAAAAAAAAAAAGG + Intronic
1057389560 9:94631479-94631501 GTTCAGTGTCACAAAGTCCATGG - Intronic
1059221185 9:112620567-112620589 ACTCCACGACACAAAGTCCATGG - Intronic
1062645991 9:137548442-137548464 CATCCGTGCCAGAAAATCCAGGG + Intronic
1062700301 9:137897570-137897592 ACTCCGTCTCAAAAAATAAAAGG + Intronic
1186812750 X:13206412-13206434 TCTCCATGACACAGAATCCAGGG + Intergenic
1189763201 X:44343592-44343614 GCTCAGTGTCCGAAAATCCAGGG + Exonic
1198621699 X:138519215-138519237 ATTCTGTGTCACTAAGTCCAGGG + Intergenic
1199682399 X:150235817-150235839 ACTCCGTCTCAAAAAAACAAAGG + Intergenic