ID: 1149470884

View in Genome Browser
Species Human (GRCh38)
Location 17:56914210-56914232
Sequence CCGCGGGAGCTCTTGGGGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149470884_1149470901 16 Left 1149470884 17:56914210-56914232 CCGATCCCCAAGAGCTCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1149470901 17:56914249-56914271 CGGGCTCGGCCTTAGCCCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 105
1149470884_1149470900 15 Left 1149470884 17:56914210-56914232 CCGATCCCCAAGAGCTCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1149470900 17:56914248-56914270 CCGGGCTCGGCCTTAGCCCCCGG 0: 1
1: 0
2: 1
3: 7
4: 174
1149470884_1149470897 -3 Left 1149470884 17:56914210-56914232 CCGATCCCCAAGAGCTCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1149470897 17:56914230-56914252 CGGGCTGGGCGCGGGACGCCGGG 0: 1
1: 0
2: 2
3: 35
4: 343
1149470884_1149470898 2 Left 1149470884 17:56914210-56914232 CCGATCCCCAAGAGCTCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1149470898 17:56914235-56914257 TGGGCGCGGGACGCCGGGCTCGG 0: 1
1: 1
2: 0
3: 27
4: 279
1149470884_1149470896 -4 Left 1149470884 17:56914210-56914232 CCGATCCCCAAGAGCTCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1149470896 17:56914229-56914251 GCGGGCTGGGCGCGGGACGCCGG 0: 1
1: 0
2: 3
3: 64
4: 560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149470884 Original CRISPR CCGCGGGAGCTCTTGGGGAT CGG (reversed) Intergenic
900156084 1:1203785-1203807 CCTGGGGAGCTCCTGGGGAGGGG + Exonic
900229107 1:1547225-1547247 CCGTGGGGGCTCCTGGGGATGGG + Intronic
902149631 1:14432731-14432753 CACCGGGACCTCTTGGGGGTTGG - Intergenic
903914745 1:26755570-26755592 CCTCTGTAGCTCTTGGGGCTGGG - Intronic
905245746 1:36612096-36612118 CTAAGGGTGCTCTTGGGGATGGG + Intergenic
907712882 1:56900756-56900778 CCCCAGGAGGGCTTGGGGATTGG - Intronic
909726331 1:78840600-78840622 CTGTGGGAGCTCTTCGGGGTTGG - Intergenic
912642715 1:111362456-111362478 CACCGGGACCTGTTGGGGATGGG - Intergenic
913252440 1:116923014-116923036 CTGCGTCAGCTCTTGGTGATGGG + Intronic
914676092 1:149908564-149908586 CAGTGGGAGCACTTGGGGCTTGG - Intronic
915722822 1:157996495-157996517 CAGGGGGAGCTCTGGGGGCTGGG - Intronic
919910379 1:202107254-202107276 ATGCGGGAGCTAGTGGGGATAGG - Intergenic
922903178 1:229154289-229154311 CCTTGGGAGCCCTTGGGCATTGG + Intergenic
922937874 1:229434859-229434881 GCGCGGGGGCTCCCGGGGATAGG + Intergenic
1064195959 10:13244288-13244310 CCGAGGCAGGTCTTGGGGAAAGG + Intergenic
1064349988 10:14567928-14567950 CAGCAGGAGCTTTTTGGGATGGG - Intronic
1070720236 10:78751920-78751942 CCGAGGGAGCTTTTGGGGAGTGG + Intergenic
1073563584 10:104517142-104517164 CAGCGGGAGCTCAGGGGGACAGG + Intergenic
1077173600 11:1179027-1179049 CCCCGCGGGCTCTTGGGGACCGG - Intronic
1081488277 11:43547944-43547966 GCGCGGGAGCTCTCGGGGCGAGG + Intergenic
1083234233 11:61341645-61341667 CTGGGGGAGCTCCTGGGGACTGG + Intronic
1083671736 11:64303852-64303874 TCGTGGGAGTTCTTGGGGGTTGG - Intronic
1089001318 11:115054602-115054624 CCACGGGAGCTATTTGGCATGGG + Intergenic
1089317182 11:117600207-117600229 CGGCGGGAGTTCCTGGGGACGGG + Intronic
1089606171 11:119642643-119642665 CCTCGGCATCTCTGGGGGATTGG + Intronic
1091226009 11:133956784-133956806 GCGCGGGAGCACTTTGCGATAGG - Exonic
1093619650 12:21273708-21273730 CCTGGGGAGCTCTGGGGGAAAGG + Intronic
1093948371 12:25135823-25135845 CTGCGGCTGCTCTAGGGGATGGG - Intronic
1095465537 12:42484192-42484214 GCGCGGGACCTCGTGGAGATCGG - Intronic
1097247509 12:57614678-57614700 CTGCCGGAGCTCCTGGGGACAGG - Exonic
1101916469 12:108900041-108900063 CCTCTGGAGCTCTTTGGGATAGG + Intronic
1102520664 12:113475991-113476013 CCGCGCTGGCTCTTGGGGGTGGG - Intergenic
1105016053 12:132787470-132787492 TCCCGGGGGCTCTTGGGGAGGGG - Intronic
1105444005 13:20436975-20436997 CCACGGGACCTCTAGGGGACTGG - Intronic
1126902151 15:53325560-53325582 CCGTGGCAGCTGTGGGGGATGGG - Intergenic
1129600779 15:76996855-76996877 CAGCTGGAGCCCTGGGGGATGGG + Intronic
1132742552 16:1422395-1422417 CAGCCGGAGCATTTGGGGATAGG - Intergenic
1132945285 16:2528814-2528836 CCACAGGAGCTCCTGGGCATTGG + Intronic
1134523677 16:14929370-14929392 ACGCGGGAGCGCGTGAGGATGGG - Intronic
1137923778 16:52519728-52519750 CAGCAGGAGCTCTTGGGCCTGGG + Intronic
1141700663 16:85640629-85640651 CCACGGCAGCTCATGAGGATGGG - Intronic
1141729543 16:85812464-85812486 CAGCGGGAGCTCTTGGGAGTAGG + Intergenic
1143555484 17:7657125-7657147 CCCAGGGAGCTCTGGGGGAGGGG + Exonic
1144781211 17:17809580-17809602 CGGCGGGGGCTCCTGGGGGTGGG - Intronic
1148029125 17:44608026-44608048 CAGCAGGAGCTCTTGGGGGCAGG + Intergenic
1148478001 17:47941781-47941803 CCGCGGTAACTCTTGCGCATGGG - Exonic
1149470884 17:56914210-56914232 CCGCGGGAGCTCTTGGGGATCGG - Intergenic
1151526398 17:74671823-74671845 ATGCGTGAGCTCTTGGGGAAGGG + Intronic
1160534265 18:79584021-79584043 CCCCGGGTGCTCCTGGGCATAGG + Intergenic
1160843583 19:1157059-1157081 CTGCGGGAGGGCCTGGGGATCGG - Intronic
1161039140 19:2100748-2100770 CCCCGGGGGCTCCTGGGGAAGGG + Intergenic
1161628807 19:5341012-5341034 CCGCGGGAGCACGTGGGGCGCGG + Intergenic
1161734617 19:5983868-5983890 CCGCAGGAGCTGTTGGGGTTTGG - Intergenic
1162013275 19:7830576-7830598 CTGCAGGAGCTCCTGGGGAGGGG - Intronic
1162967406 19:14162493-14162515 TCCTGTGAGCTCTTGGGGATCGG - Intronic
1165488679 19:36110899-36110921 CCTGGGGAGCTTTTGAGGATAGG - Intergenic
928371355 2:30742258-30742280 AGACGGAAGCTCTTGGGGATGGG + Intronic
936241380 2:110791090-110791112 CAGGTGGAGCTCCTGGGGATTGG - Intronic
937232092 2:120404163-120404185 CCCCTGGAGCTTGTGGGGATTGG + Intergenic
938599368 2:132821553-132821575 CAGCAGGAGCTGTTGTGGATAGG + Intronic
942216018 2:173719809-173719831 CATAGGCAGCTCTTGGGGATTGG - Intergenic
944432084 2:199644704-199644726 CTGCGGCTGCTGTTGGGGATGGG + Intergenic
948127201 2:235572857-235572879 CTGCGGGAGCTCCTGGTGTTGGG + Intronic
1172596395 20:36154018-36154040 CCCAGGGACCTATTGGGGATGGG - Intronic
1173929367 20:46806030-46806052 CCGCGGGCGCTGTTGGGGTCTGG - Intergenic
1178261675 21:31105755-31105777 TTGGGAGAGCTCTTGGGGATAGG + Intergenic
1181058365 22:20270350-20270372 CAGAGGGAGCGCTGGGGGATGGG + Intronic
1181374397 22:22444385-22444407 CACCGGGGCCTCTTGGGGATGGG + Intergenic
1182115087 22:27751851-27751873 ACTGGGGAGCGCTTGGGGATTGG - Intronic
1182477134 22:30582370-30582392 CCCAGGGAGCTCTTGGGAAATGG + Intronic
1184100310 22:42338490-42338512 CTGAGCGAGCTCTTCGGGATTGG - Intronic
1184229652 22:43151733-43151755 CCGGGGCAGCACTTGGGGCTCGG + Intronic
1185251694 22:49805386-49805408 GCACGGGAGCTCTTGCTGATGGG - Intronic
1185351275 22:50340755-50340777 CGGCGGGAGGTCATCGGGATGGG + Intergenic
950430555 3:12948446-12948468 ACTGGGGAGCTCATGGGGATGGG + Intronic
960936679 3:122908539-122908561 AGGCGGAAGCTCTTGGGGAGTGG - Intergenic
961322372 3:126084383-126084405 CCGCGGGAGCGCTACGGGAGAGG + Intronic
969087179 4:4665177-4665199 CCTCTGAAGCTCTTGGGGGTGGG + Intergenic
974165084 4:58191224-58191246 CTGCGGCTGCTGTTGGGGATGGG - Intergenic
980956741 4:139436361-139436383 CCGCGGGGCCTGTTGGGGCTGGG + Intergenic
983056466 4:163103304-163103326 CGGAGGGAGGTATTGGGGATAGG + Intergenic
984681027 4:182609050-182609072 CAGTGGCAACTCTTGGGGATGGG + Intronic
999111011 5:149121440-149121462 CCAAGGGAGCTCTTGGGCACAGG - Intergenic
1001652576 5:173326713-173326735 CTGCGGGAATTCTAGGGGATTGG - Intronic
1005870475 6:29971357-29971379 CAGAGGGAACTCTTAGGGATGGG + Intergenic
1007586219 6:42991439-42991461 CCTCGCGAGGTCCTGGGGATAGG - Intronic
1018469327 6:164082134-164082156 CCACGAGAGCTCCTGGGGACAGG - Intergenic
1018625127 6:165770847-165770869 CCCCGGGAGCACCTGGGGACAGG - Intronic
1019324738 7:432518-432540 CCCGGGGAGTTCTTGGGGCTGGG + Intergenic
1019434143 7:1013027-1013049 CCGCGGCAGGTCGTGGGGAATGG + Intronic
1019893013 7:3962274-3962296 CCGCGGGAGGGCTTGGGCACAGG - Intronic
1021513184 7:21456143-21456165 CCTCTGGAGCACTTGGGGCTTGG + Intronic
1028622110 7:92836409-92836431 CCGGGGGAGATCTGGGGGATTGG - Intronic
1032726169 7:134591823-134591845 CCGCAGAAGCTCTTGGTGAGGGG - Intergenic
1036560703 8:9898584-9898606 CCGCGAAAGCGCTTGGGGGTTGG - Intergenic
1043844942 8:85152896-85152918 ACGCGGGAGCCCATGGGGGTGGG - Intergenic
1044846517 8:96387236-96387258 CCGCAGAAGCTCTTAGGAATCGG - Intergenic
1049361614 8:142214759-142214781 GGGCGGGAGCTCTTGGGGCCTGG - Intronic
1053152087 9:35749606-35749628 CCGAGGGAGCTCCTGGATATAGG - Intronic
1055415055 9:76072770-76072792 CAGTGGGAGGACTTGGGGATGGG - Intronic
1060192206 9:121600132-121600154 CCGCTGGAAGCCTTGGGGATCGG - Intronic
1062413103 9:136434548-136434570 AGGTGGGAGCTCTGGGGGATGGG + Intronic
1062617475 9:137404298-137404320 CCACGCCAGCTCTTGGGGAAGGG + Intronic
1196749852 X:119106153-119106175 CATTGGGAGCTCTTGGGGAGAGG + Intronic
1200073187 X:153538906-153538928 GCGAGGGAGCTCCTGGGGAATGG + Intronic