ID: 1149470897

View in Genome Browser
Species Human (GRCh38)
Location 17:56914230-56914252
Sequence CGGGCTGGGCGCGGGACGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 343}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149470884_1149470897 -3 Left 1149470884 17:56914210-56914232 CCGATCCCCAAGAGCTCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1149470897 17:56914230-56914252 CGGGCTGGGCGCGGGACGCCGGG 0: 1
1: 0
2: 2
3: 35
4: 343
1149470883_1149470897 4 Left 1149470883 17:56914203-56914225 CCGCGCTCCGATCCCCAAGAGCT 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1149470897 17:56914230-56914252 CGGGCTGGGCGCGGGACGCCGGG 0: 1
1: 0
2: 2
3: 35
4: 343
1149470887_1149470897 -8 Left 1149470887 17:56914215-56914237 CCCCAAGAGCTCCCGCGGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1149470897 17:56914230-56914252 CGGGCTGGGCGCGGGACGCCGGG 0: 1
1: 0
2: 2
3: 35
4: 343
1149470891_1149470897 -10 Left 1149470891 17:56914217-56914239 CCAAGAGCTCCCGCGGGCTGGGC 0: 1
1: 0
2: 0
3: 19
4: 167
Right 1149470897 17:56914230-56914252 CGGGCTGGGCGCGGGACGCCGGG 0: 1
1: 0
2: 2
3: 35
4: 343
1149470881_1149470897 26 Left 1149470881 17:56914181-56914203 CCCATGAGCTGGCGAAGGTCGGC 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1149470897 17:56914230-56914252 CGGGCTGGGCGCGGGACGCCGGG 0: 1
1: 0
2: 2
3: 35
4: 343
1149470889_1149470897 -9 Left 1149470889 17:56914216-56914238 CCCAAGAGCTCCCGCGGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1149470897 17:56914230-56914252 CGGGCTGGGCGCGGGACGCCGGG 0: 1
1: 0
2: 2
3: 35
4: 343
1149470882_1149470897 25 Left 1149470882 17:56914182-56914204 CCATGAGCTGGCGAAGGTCGGCC 0: 1
1: 0
2: 1
3: 12
4: 88
Right 1149470897 17:56914230-56914252 CGGGCTGGGCGCGGGACGCCGGG 0: 1
1: 0
2: 2
3: 35
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149470897 Original CRISPR CGGGCTGGGCGCGGGACGCC GGG Intergenic