ID: 1149473461

View in Genome Browser
Species Human (GRCh38)
Location 17:56939175-56939197
Sequence CAAAATGAAGTGCCTAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149473461 Original CRISPR CAAAATGAAGTGCCTAAACT GGG (reversed) Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
908599229 1:65720923-65720945 CAAAATGAAGTGGCAGAACCAGG + Intergenic
909387954 1:75081870-75081892 CAAAGTGAAGTGACTAACCTTGG + Intergenic
909768965 1:79396198-79396220 CTAAAAGCAGTGCCTAGACTTGG + Intergenic
910040502 1:82845469-82845491 AGAAATGAAATGCTTAAACTGGG - Intergenic
911520631 1:98925967-98925989 CACAATGAATAGCCTAGACTTGG - Intronic
914926118 1:151889603-151889625 CAAAATGAAGTACCCACACATGG + Intronic
918747866 1:188228832-188228854 CAAAATAAATTGCTTACACTGGG - Intergenic
919150552 1:193691740-193691762 CAAAATTAAGTACATAAAATTGG - Intergenic
1065088079 10:22200365-22200387 CAAAATGTTGTGCTTAAAATTGG - Intergenic
1065089231 10:22213499-22213521 CAAAATTAGGTACCTAATCTTGG - Intergenic
1066567984 10:36740609-36740631 CTAAATTAAGAGCCTAAACTAGG - Intergenic
1067679366 10:48418850-48418872 CACAATGAAGTGCTTGAAATTGG + Intronic
1068020287 10:51573606-51573628 CAAAATCCAGTGCCTAATTTTGG + Intronic
1068928299 10:62562737-62562759 CAAAGTGAATTGCTTAAATTAGG - Intronic
1073432669 10:103496731-103496753 CAAATTAAAGTGGCAAAACTTGG + Intronic
1074972954 10:118556716-118556738 AAAAATACAGTGCCTAAAATTGG - Intergenic
1077657892 11:4039697-4039719 CAAAATGAATTACCTTATCTGGG + Intronic
1079611096 11:22433261-22433283 AAAAATGAAATGCCTAAAGCAGG - Intergenic
1080287985 11:30638916-30638938 CAAAATGAAGTACTTAAAATTGG - Intergenic
1083393343 11:62371650-62371672 CGAAAATAAGTGCCTAAACAAGG + Intronic
1084731238 11:71075086-71075108 CAAAACAAAGTGCCTTAAATTGG - Intronic
1085264188 11:75226878-75226900 CAAAATGATCTGCATTAACTTGG - Intergenic
1086175879 11:83890407-83890429 GAAAATGAAGTGACTTATCTAGG - Intronic
1086191458 11:84084227-84084249 GAAAACGAAATGCATAAACTGGG + Intronic
1087175098 11:95089248-95089270 TTAAAGGAAGTTCCTAAACTAGG - Intergenic
1089321404 11:117629071-117629093 GAACATGAACTTCCTAAACTCGG + Intronic
1091141981 11:133243255-133243277 CCAAATGAAGTGCCTGGAGTGGG + Intronic
1091351692 11:134902970-134902992 CAAGGTGCAGTGCCTAATCTCGG - Intergenic
1091466371 12:688299-688321 CAAGTTGCAGTGCTTAAACTTGG - Intergenic
1091991685 12:4960842-4960864 CAAAGTGAGGTGCCTCAGCTGGG + Intergenic
1092039416 12:5370820-5370842 CAAAAGGAAGTTTTTAAACTAGG - Intergenic
1092673738 12:10892156-10892178 CAAACAGAAGGGCCTCAACTAGG - Intronic
1094419013 12:30250894-30250916 CAGAATTAAGTGCCTGAATTTGG - Intergenic
1094463599 12:30726125-30726147 CAAATTCAAGAGCCTAATCTAGG + Intronic
1098012119 12:66064381-66064403 CAAAACAAAGTGCCTTACCTGGG - Intergenic
1098698314 12:73588946-73588968 CAAAAGGAAGTGGCTATCCTTGG + Intergenic
1102943281 12:116962588-116962610 GAAAAAGAAGTACATAAACTAGG - Intronic
1106209072 13:27624205-27624227 CACAAAGAAGTACCCAAACTAGG - Intronic
1108331294 13:49387247-49387269 AAAAATAAAGTGCTTAAGCTGGG + Intronic
1110041349 13:70763238-70763260 CGAAATTAGGTGCCTGAACTTGG - Intergenic
1111898113 13:94166865-94166887 CATAATTAAGTTCTTAAACTTGG - Intronic
1113167945 13:107464385-107464407 CACACTGAAGTGTCAAAACTAGG + Intronic
1114661684 14:24350193-24350215 CAAAAAGAAGAGCCTGAGCTTGG + Intergenic
1114788768 14:25631882-25631904 CAAAATGATTTGCATATACTTGG + Intergenic
1117802614 14:59460707-59460729 CCAAATGAAATACCCAAACTGGG + Intronic
1120593732 14:86407787-86407809 CAAAATAAACTTCCTAAATTAGG - Intergenic
1125346090 15:38720567-38720589 CTGAATGAAGTGCTTAAAATAGG + Intergenic
1127495760 15:59510420-59510442 CAAACTGATGTGTCTAGACTTGG - Intronic
1128027125 15:64447506-64447528 CAAAATGAAATGCTTAGAGTAGG + Intronic
1131208311 15:90471077-90471099 CAAAATGAAGGGCAAAAACCTGG - Intronic
1138756976 16:59499288-59499310 CAAAAACAAGTGAATAAACTAGG - Intergenic
1139088659 16:63617949-63617971 CAGAATGACCTGCCTGAACTCGG - Intergenic
1139540432 16:67611247-67611269 GAAAATGAAGTGTCTAAAGAGGG + Exonic
1140240334 16:73194154-73194176 AAAAAAGAAGTTCCTAAACCGGG - Intergenic
1143737111 17:8919459-8919481 CAACCTGAAGTTCCTAAACTGGG + Intronic
1144876842 17:18401526-18401548 CAAAGTAAAATGCCTAAACGAGG - Intergenic
1145155388 17:20542892-20542914 CAAAGTAAAATGCCTAAACGAGG + Intergenic
1145841871 17:28001891-28001913 GCAAAAGAGGTGCCTAAACTGGG + Intergenic
1146712497 17:35054823-35054845 TAAAATGAAGTACCTAAAAGAGG + Intronic
1149473461 17:56939175-56939197 CAAAATGAAGTGCCTAAACTGGG - Intronic
1149922579 17:60673447-60673469 CAAAAAGAACTGCTTTAACTCGG + Intergenic
1151115311 17:71728918-71728940 CAAAAAGAAGTGAGCAAACTTGG + Intergenic
1154248399 18:12720561-12720583 TAAAATAAAGAGCCTTAACTGGG + Exonic
1158339269 18:56448031-56448053 CAAAGTGAAGAGCTTGAACTTGG + Intergenic
1159534293 18:69695486-69695508 CAAAATGGAGTGGTTAAAATTGG - Intronic
1168655121 19:58121932-58121954 CAAAGTGAAGTGCCCAGCCTGGG + Intergenic
926365371 2:12128316-12128338 CCAGATGAAGTCCCTAAACAGGG - Intergenic
928419502 2:31126987-31127009 CTAAATGAGGTGCTAAAACTTGG + Intronic
931023692 2:58082445-58082467 CAAAGACAAGTGCCTAAAGTAGG + Intronic
932203644 2:69857147-69857169 GAAAATGAAGGGCTTAAAATGGG - Intronic
932269379 2:70396199-70396221 CAAAATCAAATGCCTAGGCTGGG + Intergenic
933319035 2:80748689-80748711 GAAAATAAAGTGTCTAAACTTGG + Intergenic
933886515 2:86722671-86722693 GAGAATGAAGGGCCTAGACTTGG + Intronic
933923665 2:87074034-87074056 GAGAATGAAGGGCCTAGACTTGG - Intergenic
937339896 2:121084469-121084491 CAAAATGAAGTGACTTAGCCGGG + Intergenic
939136539 2:138301868-138301890 AAATTTGCAGTGCCTAAACTAGG - Intergenic
940586849 2:155663004-155663026 CAAAATAAAGGCCCAAAACTAGG - Intergenic
941371414 2:164669731-164669753 CACAGTGAAGTGGCAAAACTGGG - Intronic
943175344 2:184466174-184466196 CATAATGAACTGCCTCCACTGGG + Intergenic
943729099 2:191282843-191282865 TAACATGAAATGCCTAGACTTGG + Intronic
943838547 2:192548088-192548110 CATATTAAAGTGCCTAAAATGGG + Intergenic
946141241 2:217692421-217692443 AAGAATGCATTGCCTAAACTAGG - Intronic
947511616 2:230759852-230759874 TAAAATGACTTGCCTAAACACGG + Intronic
948031737 2:234823354-234823376 CAGAGTGAAGTGCCATAACTTGG + Intergenic
1168898503 20:1340351-1340373 CAAGATGAAGTGCCTCAAGTAGG - Intronic
1169386825 20:5156971-5156993 CTAAATTATGTGCCTACACTTGG + Intronic
1169462926 20:5812041-5812063 GAAAAAGAAGTTCCTAGACTAGG - Intronic
1170635904 20:18104174-18104196 AAAAAAAAAGTGCCTAAACTAGG + Intergenic
1176945216 21:14972105-14972127 GAAAATGAAGTGTCTATCCTAGG + Intronic
1178719719 21:34997860-34997882 CAAAATGAAGCGCCCAGATTGGG - Intronic
1178720856 21:35007734-35007756 CAAAATAAAGGGCCTGAACGAGG - Intronic
1180406479 22:12560395-12560417 CAAGTTGAAGTGACTGAACTCGG + Intergenic
1183444232 22:37842562-37842584 CCAAATGATTTGCCTAAATTTGG + Intronic
951928781 3:27940350-27940372 CAAAAAGAAAGGCTTAAACTTGG + Intergenic
952197003 3:31086244-31086266 CAGGATGAAGTCCCTAAACTGGG - Intergenic
953835066 3:46335356-46335378 CAGATTGAAGTCCATAAACTTGG + Intergenic
954096110 3:48330041-48330063 CTAAATGAATGGCCTTAACTGGG + Intergenic
954424173 3:50434647-50434669 CACAATGACCAGCCTAAACTGGG - Intronic
959866652 3:111278308-111278330 CAAAATAAAGGGCCTAAACTTGG - Intergenic
960020029 3:112938999-112939021 CAAAATGAAGAACAAAAACTAGG + Intronic
967128267 3:186446312-186446334 CCAAATGAAGTGCCTCAACTGGG + Intergenic
967249432 3:187521541-187521563 CAAAAAGTAGTGGCTAAAATAGG - Intergenic
968376181 4:43861-43883 CAAAATGAATTGCATAAAATCGG + Intergenic
970622237 4:17834937-17834959 AAAAATGAAGTGATTAAAGTGGG + Intronic
971236570 4:24847843-24847865 CAAAGTGAAGTCACTGAACTTGG - Intronic
972238459 4:37161816-37161838 CATAACGAAGTGCCCAGACTGGG + Intergenic
972447477 4:39158960-39158982 CTAAATGCAGTGCATAAACCTGG - Intergenic
973309007 4:48686700-48686722 CAAAATGAAATACCTAGACATGG - Intronic
973812548 4:54585657-54585679 CTAAATGTAGTGACTAAAATGGG + Intergenic
975395080 4:73865243-73865265 CATGATGAAGTGTCCAAACTCGG + Intergenic
975481144 4:74881804-74881826 CAAGATGAAGTGCTTATATTAGG + Intergenic
978768313 4:112427961-112427983 CAAAATGCAGTTTCCAAACTTGG + Intronic
980719436 4:136674952-136674974 GATAATGAAGTGACTAAACTTGG - Intergenic
980754253 4:137136916-137136938 CAAAATGAAAAACATAAACTTGG + Intergenic
981311753 4:143304392-143304414 AAAAATGCATTCCCTAAACTTGG + Intergenic
981436282 4:144726785-144726807 GAAAAGGAAGTGCCTGTACTGGG + Intronic
981671182 4:147288743-147288765 CATCATGAATTGCCTAAACTGGG - Intergenic
983010960 4:162546517-162546539 CAAAATGAATTGGCAAAAGTGGG - Intergenic
988989507 5:36655788-36655810 CAAAATTAAATGCCTAAAACTGG - Intronic
989185433 5:38620779-38620801 CTAAATTAAGTTCCTAAATTAGG - Intergenic
991275498 5:64841978-64842000 CAAAAGTAAATACCTAAACTTGG - Intronic
992158933 5:73981840-73981862 CCAAGTGAAGTGCCTGCACTCGG - Intergenic
994964236 5:106646633-106646655 CATAATGAAGTGTGTAAATTTGG - Intergenic
995206196 5:109484135-109484157 CAAACTCAAGTGGCTAAAATTGG + Intergenic
997844742 5:137276318-137276340 CGAGAAGAAGTGTCTAAACTGGG - Intronic
999980922 5:156957170-156957192 CAAAGTGAAGAGACTAAATTCGG - Intronic
1003895725 6:10605801-10605823 AAAAAAGAACTTCCTAAACTTGG + Intronic
1005609262 6:27507808-27507830 CAAAATGAAGTGAGTCAGCTGGG - Intergenic
1006958489 6:37901128-37901150 CAGAATGAATTGCCAAAAATTGG - Intronic
1007441307 6:41863271-41863293 CATAATGAAGAGCCTAGACTAGG - Intronic
1007951147 6:45873492-45873514 CAAAATGAAGTAACAAAAATAGG - Intergenic
1012016357 6:93857186-93857208 CAAAATGAACTGCCTCACCTGGG + Intergenic
1012563277 6:100614096-100614118 AAATATGAAGTGCTTACACTGGG - Intronic
1013929136 6:115509348-115509370 CAAATTAAAGTAGCTAAACTTGG + Intergenic
1014428024 6:121333200-121333222 CAAAATGAAATGCAAACACTGGG + Intronic
1014783180 6:125588015-125588037 CAAAATTTAGTGCCTACATTGGG - Intergenic
1015289362 6:131520624-131520646 CAAAAGTAAGTGCCTGAACTGGG - Intergenic
1015342221 6:132114010-132114032 CCAAATGAGGAGCCTAAATTTGG - Intergenic
1016633475 6:146259192-146259214 CAAAATTGATTGTCTAAACTAGG - Intronic
1017919657 6:158860203-158860225 CTAAATGAAGTGCCTGATCCTGG - Intergenic
1020229907 7:6310189-6310211 CAAAGTGTAGTCCATAAACTGGG + Intergenic
1020469575 7:8520807-8520829 GAAAATGAAGTGACAAAACCCGG - Intronic
1020549747 7:9587995-9588017 TAAAATAAAGTGCTTAAAATAGG - Intergenic
1024221452 7:47291312-47291334 AAATATCAAGTCCCTAAACTAGG + Intronic
1027891138 7:83976834-83976856 CAAAATGAAGTACTTAAACATGG + Intronic
1027993979 7:85400014-85400036 TAAAATGAATTGCCTTAATTAGG + Intergenic
1028160288 7:87476557-87476579 CAAAAGGAAGTGTCTAAAACGGG + Intronic
1028312688 7:89358826-89358848 CAAAATGAAGTGACAGAAATAGG + Intergenic
1028950034 7:96624348-96624370 CAAAATGAGGAACTTAAACTTGG - Intronic
1030045675 7:105493213-105493235 CCAAATGAAATGCTAAAACTGGG + Intronic
1035897857 8:3424289-3424311 CAAAATTAATAGACTAAACTAGG - Intronic
1038370872 8:26989083-26989105 CACAATGATGTGCCTTAACGTGG - Intergenic
1039591211 8:38750965-38750987 CAAAACGATGTGGCTATACTAGG - Intronic
1040636172 8:49275490-49275512 CGAAATGAAGAGAATAAACTAGG - Intergenic
1043140714 8:76586401-76586423 CAAAATAAAATGCCAAGACTTGG + Intergenic
1045798272 8:106071456-106071478 CCAAATGAAGTGGCTAAGTTAGG + Intergenic
1045809737 8:106207328-106207350 CAAGATGAAGTGGCCAAAGTGGG - Intergenic
1046340661 8:112850216-112850238 AGAAATGGAGTGACTAAACTTGG + Intronic
1049833956 8:144721107-144721129 GAAAATGAAATGCAAAAACTGGG + Exonic
1051789714 9:20787107-20787129 CAAACTTAAGAGCCTAAACCTGG + Intronic
1051990156 9:23143251-23143273 CAATATAAAGTGCCTTAAATTGG - Intergenic
1052729737 9:32271272-32271294 TAAAAGGAAGTGACTGAACTGGG + Intergenic
1056777271 9:89522569-89522591 AAAGAGGAAGTGCCTAAGCTGGG - Intergenic
1057629637 9:96708891-96708913 CAAAGTGGAGTGCCCAAACATGG + Intergenic
1058515311 9:105766536-105766558 AAAAAGGAAGAGCATAAACTGGG - Intronic
1058589340 9:106545956-106545978 AAAAATTATGTGCTTAAACTTGG + Intergenic
1060673219 9:125488844-125488866 CAGAAAGAAGTGCCTAAAAATGG + Intronic
1203573044 Un_KI270744v1:150289-150311 CAAAATGAATTGCATAAAATCGG - Intergenic
1186643011 X:11476494-11476516 CAAAATGTATTGGCTAATCTGGG - Intronic
1187811789 X:23187236-23187258 TAAAATGTAGTGCCTGAAATAGG - Intergenic
1188951884 X:36386329-36386351 CAAAATGAAGGGACTATACTAGG + Intergenic
1190370011 X:49731310-49731332 GAAACTGTAGTGCCAAAACTGGG + Intergenic
1192040865 X:67620045-67620067 CAACATGAAATGTCTAACCTTGG + Intronic
1193602385 X:83523678-83523700 TAGAATGAAGTGTCTAGACTTGG - Intergenic
1193988947 X:88282173-88282195 CAAAAAGAAGTGCCCATTCTTGG - Intergenic
1194805136 X:98318044-98318066 CAAAGTGAAGTGGCTAAAAAGGG + Intergenic
1197238738 X:124098626-124098648 CAAACTGAAGTGTCTACATTAGG - Intronic
1201273815 Y:12280848-12280870 CCAAATCATGTGCCTAAGCTTGG - Intergenic
1201339537 Y:12918505-12918527 CAAAATAAATTTACTAAACTTGG + Exonic
1201424436 Y:13832967-13832989 TAAAATGAAGTGAATAAAGTGGG + Intergenic
1201728173 Y:17177302-17177324 TAAAATGAGGTTACTAAACTGGG + Intergenic