ID: 1149474944

View in Genome Browser
Species Human (GRCh38)
Location 17:56952975-56952997
Sequence GAGTACTCAAAAATGCCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 3, 3: 4, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149474943_1149474944 -2 Left 1149474943 17:56952954-56952976 CCTCAATGTTAAGCAAATTGTGA 0: 1
1: 0
2: 0
3: 22
4: 240
Right 1149474944 17:56952975-56952997 GAGTACTCAAAAATGCCTGTTGG 0: 1
1: 0
2: 3
3: 4
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149474944 Original CRISPR GAGTACTCAAAAATGCCTGT TGG Intronic
908614975 1:65910172-65910194 GAGTGCTTAAAAATGGCTGAAGG + Intronic
912202513 1:107474338-107474360 GATCACTGAAAGATGCCTGTTGG + Intronic
913690871 1:121278748-121278770 GAGGACTCAAAAATCCTTGCTGG - Intronic
914146669 1:145001215-145001237 GAGGACTCAAAAATCCTTGCTGG + Intronic
920478193 1:206297233-206297255 GAGGACTCAAAAATCCTTGCTGG - Intronic
921380480 1:214519451-214519473 GAGTTCTCAATAATGCCTGCTGG + Intronic
921827489 1:219689800-219689822 AAGTGTTCAAAAATGCTTGTAGG - Intronic
1065121931 10:22538738-22538760 GAGTACTCAAAAATTTCTGTTGG + Intronic
1065426046 10:25604860-25604882 TAGTAATCAAAAATTCCAGTTGG - Intergenic
1066794280 10:39101755-39101777 GGGTACTCAAACAGGCCTATGGG + Intergenic
1066795470 10:39115244-39115266 AAGTGCTCAAAAAGGCCTATGGG + Intergenic
1067384713 10:45808199-45808221 GAATGTTCAAAAATGCCTTTGGG + Intergenic
1067390779 10:45861329-45861351 CAGTACTCTAAAATGACTTTTGG + Intergenic
1067500694 10:46802521-46802543 CAGTACTCTAAAATGACTTTTGG - Intergenic
1067593890 10:47537379-47537401 CAGTACTCTAAAATGACTTTTGG + Intronic
1067641001 10:48045492-48045514 CAGTACTCTAAAATGACTTTTGG + Intergenic
1067872500 10:49974775-49974797 CAGTACTCTAAAATGACTTTTGG - Intronic
1070137965 10:73711546-73711568 CAGTACTCTAAAATGACTTTTGG + Intergenic
1071119873 10:82264804-82264826 GAGAACTGAGAATTGCCTGTTGG + Intronic
1071707081 10:88010996-88011018 TAGGACTGAAAAATGTCTGTTGG + Intergenic
1074959751 10:118432447-118432469 GCATACTCCAAAATGGCTGTTGG + Intergenic
1085521090 11:77139271-77139293 GGGTACTCCAAAACCCCTGTGGG - Intronic
1085625032 11:78065253-78065275 GAGTATGCAGACATGCCTGTTGG + Intronic
1086126466 11:83353748-83353770 GACTACTTCAAAATGGCTGTGGG - Intergenic
1086939217 11:92778254-92778276 AAGCACTAAAAAATGCCAGTTGG - Intronic
1088673873 11:112171590-112171612 GAGTAGTCAAAAATATTTGTGGG + Intronic
1089586668 11:119513825-119513847 CAGAAGTGAAAAATGCCTGTGGG + Intergenic
1092470985 12:8780816-8780838 ATGTAATCATAAATGCCTGTAGG + Intronic
1094686002 12:32715430-32715452 CAGTACAGAAAAATGCTTGTAGG + Intronic
1097180238 12:57167671-57167693 GAGAAGTCAGAAATGCCTGGAGG + Intronic
1097914534 12:65006523-65006545 GAGTAATCAGAAATGATTGTTGG + Intergenic
1098530867 12:71540274-71540296 GAGTACTATTTAATGCCTGTTGG + Intronic
1098941633 12:76543287-76543309 GGATACTGAAAAATGCCTCTAGG - Intronic
1099704706 12:86137207-86137229 AAGTAGTCAAGAATGGCTGTAGG - Intronic
1100890333 12:99118744-99118766 GAGCAGTCAAAAATGACTGCAGG + Intronic
1108177466 13:47807957-47807979 AAGGACTGAAAAATCCCTGTTGG + Intergenic
1108933409 13:55860164-55860186 GAGTAAAAAAAAATCCCTGTGGG + Intergenic
1113659114 13:112092668-112092690 GAGTATTCAAAGATGCCAGCAGG + Intergenic
1114220195 14:20689533-20689555 GAATACTGAACATTGCCTGTGGG + Intronic
1116132537 14:40875122-40875144 GAGTACTCAAACATCTCTGAAGG + Intergenic
1118959853 14:70519009-70519031 GAATACACAAATATGCCTCTTGG + Intergenic
1119002820 14:70898530-70898552 GGGGACTGAAAAATGCCTGCTGG + Intergenic
1119649194 14:76371739-76371761 GATTCTCCAAAAATGCCTGTTGG + Intronic
1121924668 14:97916715-97916737 TTGTTCTCAAAAAAGCCTGTGGG - Intergenic
1123970200 15:25501110-25501132 GAGAACACAAGGATGCCTGTCGG - Intergenic
1130334713 15:82949071-82949093 GAGGACTCAAACATGACTCTTGG + Intronic
1139328971 16:66173005-66173027 CAGAAATCAAAAAGGCCTGTGGG - Intergenic
1140612578 16:76619074-76619096 AAGGACTGAAAAATGCCTATTGG + Intronic
1148668732 17:49394292-49394314 AGGTACTCAATAATACCTGTTGG + Intronic
1149219030 17:54393421-54393443 AAGTAATCAAATCTGCCTGTAGG - Intergenic
1149474944 17:56952975-56952997 GAGTACTCAAAAATGCCTGTTGG + Intronic
1151401822 17:73860672-73860694 GAGAACTCAAACATTCCTCTGGG + Intergenic
1152290426 17:79437071-79437093 GAGCACTCAAAGGTCCCTGTTGG - Intronic
1152495825 17:80670805-80670827 GAGTAATCAGAAATGAATGTGGG - Intronic
1156274558 18:35571353-35571375 GAGACATTAAAAATGCCTGTGGG + Intergenic
1157634105 18:49132028-49132050 GAAGTCTCAAAAATGGCTGTTGG - Intronic
1158245511 18:55428147-55428169 GAGTACTCAACAGTGTCTCTTGG - Intronic
1165640046 19:37376779-37376801 GAGTACTCATATGTGCCTGCTGG - Intronic
1165642172 19:37398845-37398867 GAGATCTCAAAAATGTCTTTGGG + Intergenic
927013632 2:18932797-18932819 GAGTAGTAAACAATGCATGTAGG + Intergenic
931036378 2:58248591-58248613 AAGTACTCATAAATAACTGTGGG - Intergenic
931790895 2:65663308-65663330 CTGTACTGAAAAATGTCTGTAGG - Intergenic
931944766 2:67293795-67293817 GAGTTCTCACAATTGCCTATGGG - Intergenic
931995632 2:67836818-67836840 GAGCCCACAAAAATGCCTTTGGG - Intergenic
939521308 2:143234224-143234246 GAGTCTTAAAAAATGCCTGCAGG - Intronic
942535227 2:176956118-176956140 TAGTTCTCAAAAATAACTGTAGG - Intergenic
942714761 2:178879600-178879622 GGGTACTCAAAAATAGCTCTAGG + Intronic
942771166 2:179522558-179522580 GACTACTCAAAAATTACTGGAGG + Intronic
942786100 2:179704831-179704853 CTGTACTCAAAAATGCCTGGAGG - Intronic
944000011 2:194822467-194822489 AAGTACTCAAATAAGCATGTGGG + Intergenic
944291530 2:198012361-198012383 TAGTTCTCAAAAATAACTGTAGG - Intronic
945853462 2:215038471-215038493 GACAAATTAAAAATGCCTGTGGG - Intronic
946554367 2:220838331-220838353 GAAAACTCTAAAATGCTTGTGGG + Intergenic
948027500 2:234789690-234789712 GTTTACACAAAAATGTCTGTGGG - Intergenic
948456497 2:238106903-238106925 CAGTACTCAGAAGTGTCTGTTGG - Intronic
948500478 2:238389377-238389399 GAGTACTCCAAAATGCGGGAGGG - Intronic
1169686780 20:8283695-8283717 GAGTACTCAAATATGACTGTGGG - Intronic
1170115191 20:12850290-12850312 GAGTACTCAAAACCTCCAGTAGG - Intergenic
1170952075 20:20946148-20946170 GAGAGTTCAAAAATCCCTGTCGG + Intergenic
1172697049 20:36830181-36830203 CAGTCCTCACAAAAGCCTGTGGG + Intronic
1173013244 20:39201307-39201329 GAGCACCCAGAAATGCCTGATGG - Intergenic
1184292632 22:43506216-43506238 AAGTAAACAAAAATGCCTATGGG - Exonic
949293333 3:2491182-2491204 ACGTACTCAGAAATGTCTGTAGG + Intronic
949779250 3:7667383-7667405 GTGTACTCAGAAATGTCTATAGG - Intronic
951548543 3:23853758-23853780 CAGTGCTCAAAAATTCCTGGTGG + Intronic
951606836 3:24443992-24444014 GAATACTATAAAATGCCTTTTGG - Intronic
955842129 3:63123857-63123879 GTGTACCCAAATCTGCCTGTTGG + Intergenic
957169249 3:76716771-76716793 GTGTACTTAAATCTGCCTGTAGG + Intronic
958720964 3:97842716-97842738 GAATACTCAAAAATAGATGTAGG - Intronic
958776029 3:98483648-98483670 AAGTACTGAAAAAGCCCTGTAGG - Intergenic
960765351 3:121122741-121122763 AAGTATTCAAAGATGCTTGTAGG + Intronic
963006733 3:140733412-140733434 TAGCACTCAAAGATTCCTGTTGG + Intergenic
964834279 3:160920216-160920238 GGGTACCCACAAATGGCTGTGGG - Intronic
964847752 3:161062173-161062195 GAGGACTCAAAAAAGTCTGCTGG - Intronic
966149899 3:176856237-176856259 CAGTATTCAAAGAAGCCTGTAGG - Intergenic
969246238 4:5934786-5934808 GAGTACACAATAATAGCTGTTGG - Intronic
970935331 4:21563625-21563647 AAGTACTCAAATATGACAGTAGG + Intronic
971855240 4:32034353-32034375 GGGAACTTAACAATGCCTGTTGG + Intergenic
979468014 4:121062829-121062851 GAGATCTCGAAAATGCCTGGTGG + Intronic
980723959 4:136733873-136733895 GAGTATTCAAAAAAACTTGTGGG + Intergenic
981487140 4:145299211-145299233 TCATACTCAAAAATGACTGTAGG + Intergenic
987423401 5:17747057-17747079 GAGTACTAAAAAATGATCGTTGG + Intergenic
988196093 5:28007922-28007944 GAGGACATAAAAAGGCCTGTTGG + Intergenic
989602434 5:43212397-43212419 GAGTATTTAAAAATCCCTATTGG - Intronic
996568400 5:124906394-124906416 TAGGTCTCAAAAATGCATGTGGG + Intergenic
997973292 5:138422229-138422251 GAACAGTCAAAAATGCCTTTAGG - Intronic
1002268629 5:178054541-178054563 GAGTACTCACAAATTTCTGGGGG + Intronic
1002883443 6:1273091-1273113 ATGTGCTCAAAACTGCCTGTGGG + Intergenic
1005814894 6:29542533-29542555 GAGTAATCAAAAGTGTCAGTGGG - Intergenic
1007218929 6:40263200-40263222 CAGTAGTCAAAAATGTCTGGAGG + Intergenic
1007893712 6:45324537-45324559 GAGAACCCAAAAAAGCCTGAAGG + Intronic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1012417093 6:99023215-99023237 GAGTGCTTAAGAATGCCGGTAGG - Intergenic
1012604480 6:101141086-101141108 AAGTGATCAAAAATGCATGTTGG + Intergenic
1013553517 6:111233575-111233597 GAGGACTGAAAAATGACTATTGG - Intergenic
1020709570 7:11589938-11589960 GAGTTTTAAAAAATGCCTTTGGG + Intronic
1021281790 7:18728634-18728656 GAGAACTCAAAAGAGCCTTTGGG - Intronic
1022594194 7:31696392-31696414 GAGTTCTTAAAAAGGACTGTTGG + Intronic
1023466646 7:40463433-40463455 GAGTACTCAAAAATTGCTCAAGG - Intronic
1028458583 7:91065402-91065424 TATTATTCTAAAATGCCTGTTGG + Intronic
1028569479 7:92270361-92270383 GAGTACTTCAAAATGACTGGAGG - Intronic
1030452224 7:109726471-109726493 GAGTACCTAAAAATGTCTTTGGG + Intergenic
1030475014 7:110020799-110020821 GAGAAGTCCAAAATGGCTGTTGG + Intergenic
1030557382 7:111043423-111043445 CAGTACTCAAAAATGCCTATAGG + Intronic
1033205626 7:139419285-139419307 GAGTAATCAAAAATGGCTTCAGG + Intronic
1033947643 7:146741342-146741364 GAGCAGTCAAAAATGCCTTGTGG - Intronic
1034378515 7:150667762-150667784 GAGTAGTTAAAAATGTATGTGGG + Intergenic
1034783977 7:153908470-153908492 GAGTACCAAAAAATACCTATTGG + Intronic
1035040373 7:155922314-155922336 GTGTGTCCAAAAATGCCTGTGGG + Intergenic
1035588043 8:791042-791064 AATGACTCAAAAATGCATGTTGG - Intergenic
1035795987 8:2357041-2357063 GAGCACTCAAAATTCCCTATTGG - Intergenic
1037339599 8:17830362-17830384 GAATACACAAAAACTCCTGTTGG - Intergenic
1038943370 8:32330447-32330469 GTGTTCTCAGGAATGCCTGTGGG + Intronic
1039334560 8:36575117-36575139 GAGTACTCGAGAATGCCAGTGGG - Intergenic
1040713003 8:50212354-50212376 GAGTAATGAAAATTGCCTCTAGG + Intronic
1041919591 8:63167512-63167534 CAGAACTTAAAAATGCCTCTTGG + Intergenic
1044289588 8:90452264-90452286 ATCTACTCAAAAATGGCTGTGGG + Intergenic
1047681492 8:127258412-127258434 GTGGACTGTAAAATGCCTGTTGG + Intergenic
1048707511 8:137170387-137170409 GAGGACTCAAAGAAGCCTGTGGG - Intergenic
1050280566 9:4045812-4045834 GAGTACTCAAAGATATCTGACGG - Intronic
1055052094 9:71991230-71991252 GAGACCTGAAAAATGCCAGTGGG + Intergenic
1055336523 9:75237830-75237852 GAGCACTTAAGAATGCCAGTTGG - Intergenic
1057315018 9:93962589-93962611 GAGAACTCAGAAATGGGTGTAGG - Intergenic
1058689477 9:107507290-107507312 GATTTCTCAGGAATGCCTGTGGG + Intergenic
1187036280 X:15543542-15543564 TAGTACTCCAAAATGCTTGAGGG - Intronic
1187568948 X:20481397-20481419 GATCATTCAAAAATGCCAGTAGG - Intergenic
1190435987 X:50425925-50425947 CAGTTCTCAAAAATGGCTTTTGG + Intronic
1193842277 X:86421231-86421253 GAGCACTCAAAAATACTTGCTGG - Intronic
1201925728 Y:19285564-19285586 GAGTACTCAAAATTGTCCTTGGG - Intergenic