ID: 1149476867

View in Genome Browser
Species Human (GRCh38)
Location 17:56969122-56969144
Sequence CTAATTCAAAACTTATTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149476866_1149476867 4 Left 1149476866 17:56969095-56969117 CCTTTGTAAAGGGTAACTAATTT No data
Right 1149476867 17:56969122-56969144 CTAATTCAAAACTTATTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149476867 Original CRISPR CTAATTCAAAACTTATTTAA AGG Intergenic
No off target data available for this crispr