ID: 1149477263

View in Genome Browser
Species Human (GRCh38)
Location 17:56973594-56973616
Sequence GCCCACTGCCTAGACAGAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149477260_1149477263 -6 Left 1149477260 17:56973577-56973599 CCCAACGGGTTCACCTTGCCCAC No data
Right 1149477263 17:56973594-56973616 GCCCACTGCCTAGACAGAACCGG No data
1149477261_1149477263 -7 Left 1149477261 17:56973578-56973600 CCAACGGGTTCACCTTGCCCACT No data
Right 1149477263 17:56973594-56973616 GCCCACTGCCTAGACAGAACCGG No data
1149477259_1149477263 7 Left 1149477259 17:56973564-56973586 CCTGCTGTAACTGCCCAACGGGT No data
Right 1149477263 17:56973594-56973616 GCCCACTGCCTAGACAGAACCGG No data
1149477255_1149477263 9 Left 1149477255 17:56973562-56973584 CCCCTGCTGTAACTGCCCAACGG No data
Right 1149477263 17:56973594-56973616 GCCCACTGCCTAGACAGAACCGG No data
1149477257_1149477263 8 Left 1149477257 17:56973563-56973585 CCCTGCTGTAACTGCCCAACGGG No data
Right 1149477263 17:56973594-56973616 GCCCACTGCCTAGACAGAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149477263 Original CRISPR GCCCACTGCCTAGACAGAAC CGG Intergenic
No off target data available for this crispr