ID: 1149479634

View in Genome Browser
Species Human (GRCh38)
Location 17:56992319-56992341
Sequence CTGAGTCAGCATGAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 322}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149479628_1149479634 21 Left 1149479628 17:56992275-56992297 CCTCATGTTTGCCATCTGCAGGG 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1149479634 17:56992319-56992341 CTGAGTCAGCATGAAGAGGAGGG 0: 1
1: 0
2: 2
3: 35
4: 322
1149479626_1149479634 22 Left 1149479626 17:56992274-56992296 CCCTCATGTTTGCCATCTGCAGG 0: 1
1: 0
2: 5
3: 26
4: 208
Right 1149479634 17:56992319-56992341 CTGAGTCAGCATGAAGAGGAGGG 0: 1
1: 0
2: 2
3: 35
4: 322
1149479631_1149479634 10 Left 1149479631 17:56992286-56992308 CCATCTGCAGGGTAGGACTGAAG 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1149479634 17:56992319-56992341 CTGAGTCAGCATGAAGAGGAGGG 0: 1
1: 0
2: 2
3: 35
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149479634 Original CRISPR CTGAGTCAGCATGAAGAGGA GGG Intronic
900749972 1:4389447-4389469 CTCACTCATCATCAAGAGGATGG - Intergenic
901216758 1:7559398-7559420 CTGAGACAGCCTGGAGGGGAAGG - Intronic
901349186 1:8577576-8577598 CTGTGTCAGCATGATGAGTATGG - Intronic
901421546 1:9154538-9154560 CTGACTCAGGAGGAAGAGGAAGG - Intergenic
902295114 1:15461872-15461894 CTGAGGGAGGATGAAGAGGAGGG + Intronic
902297979 1:15481411-15481433 CTGAGGGAGGATGAAGAGGAGGG + Intronic
902784543 1:18724559-18724581 CTTAGTCATCCTGCAGAGGATGG + Intronic
903017723 1:20372108-20372130 CTGAGTCATCAGGAAGATGTAGG - Intergenic
903375310 1:22862109-22862131 CAGGGCCAGCAAGAAGAGGAAGG + Intronic
903557524 1:24204409-24204431 CAGACTCAGAATGAGGAGGAAGG - Intergenic
903787328 1:25870113-25870135 CTGAGCCAGCAGGATGAGGATGG + Intronic
904292348 1:29496192-29496214 CTGATTCAGCATGCAGAGCATGG - Intergenic
904565471 1:31425803-31425825 CTGGATGAGGATGAAGAGGAAGG - Exonic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
906157098 1:43620181-43620203 CTTGGTCAGCATGACGATGATGG - Exonic
906750525 1:48254893-48254915 CTGACCCAGAATGAAGAGGGAGG - Intergenic
907000634 1:50850291-50850313 CTCATTCATGATGAAGAGGAGGG + Intronic
907298950 1:53473709-53473731 CTGAGTCAGAATAAATGGGATGG - Intergenic
907857812 1:58321247-58321269 CTGCTGCAGCATAAAGAGGAAGG - Intronic
908452662 1:64271488-64271510 CTGACTCACTTTGAAGAGGATGG + Intergenic
909259056 1:73463810-73463832 CTTTGTCAGCAAGAAAAGGAGGG - Intergenic
910978520 1:92934580-92934602 CTGAGTCAGCATATACTGGAAGG + Intronic
911180082 1:94852657-94852679 GTGATTCAGTAAGAAGAGGATGG + Intronic
913582829 1:120244086-120244108 CTTAGTCAGCATGCAGAAGGAGG + Intergenic
913625343 1:120654274-120654296 CTTAGTCAGCATGCAGAAGGAGG - Intergenic
914564760 1:148855582-148855604 CTTAGTCAGCATGCAGAAGGAGG + Intronic
914608066 1:149274660-149274682 CTTAGTCAGCATGCAGAAGGAGG - Intergenic
914761728 1:150604536-150604558 ATGGGGCAGAATGAAGAGGAAGG + Intronic
914802606 1:150972351-150972373 CTGACTCAACATGAAGAGAGGGG + Intronic
915109049 1:153551400-153551422 CTGAGTCTCCAAGGAGAGGACGG - Intergenic
915853278 1:159351489-159351511 CTCAGTCATCATGAATTGGAGGG + Intergenic
919918572 1:202154204-202154226 CTGAGTGAGCATGACAATGAGGG + Exonic
919935926 1:202250941-202250963 CTGAGGAAGAATGTAGAGGAAGG - Intronic
923548236 1:234940456-234940478 CTGAGAAAGCATGGGGAGGAGGG - Intergenic
924030226 1:239878865-239878887 CTAATTCAGCCTGAGGAGGAAGG + Intronic
924078267 1:240363861-240363883 CTGAGCCAGCATGACCAGCATGG - Intronic
924710094 1:246524158-246524180 CCAAGTCAGCATGAAGGGAAGGG + Intergenic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1062990839 10:1814745-1814767 ATGGGACAGCATGAAGAGTATGG + Intergenic
1063276007 10:4568614-4568636 CTGAGTCAGAGTGAAGAGAAAGG - Intergenic
1065256243 10:23871561-23871583 CAGAGTCAGCATTCAGAGAAGGG - Intronic
1065524597 10:26607090-26607112 CTAAGTCTGCTTGAAGAAGACGG + Intergenic
1070475483 10:76825087-76825109 CTGAGTCAAGATGAAGATCAAGG - Intergenic
1070669929 10:78370566-78370588 CTGAGTGAGTTTGAAGAGAAAGG + Intergenic
1070778656 10:79125026-79125048 CTGTGGCAGCAGGAAGAGCAAGG + Intronic
1071147085 10:82588268-82588290 CTCACTCATCATCAAGAGGATGG - Intronic
1071541360 10:86487495-86487517 CTGACTCAGAAAGAAGATGAGGG - Intronic
1071766259 10:88669112-88669134 CTGAATCATCATCAATAGGAGGG + Intronic
1071847985 10:89539326-89539348 CTGAGTAGGGAAGAAGAGGAAGG - Intronic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1073771059 10:106736408-106736430 CTGTGGGAACATGAAGAGGAAGG - Intronic
1074681166 10:115909168-115909190 CTGACTGGGCATGAAGAGGAAGG - Intronic
1074737492 10:116451555-116451577 CTCACTCATCATCAAGAGGATGG - Intronic
1075416418 10:122267791-122267813 CTGAGTGTGCAAGAAGAAGATGG + Intergenic
1076343023 10:129762612-129762634 CTGTCTGAGGATGAAGAGGAAGG - Intronic
1077227393 11:1444424-1444446 CTGAGTCAGGGTGGAGAGAAGGG + Intronic
1077270915 11:1680026-1680048 CTGAGCCAGCAGGAAGAGACAGG + Intergenic
1077419067 11:2441122-2441144 ATCAGCCAGCATGAACAGGAAGG - Intergenic
1077507919 11:2940720-2940742 ATGAGTCAGCATGGCCAGGATGG + Intergenic
1079423963 11:20322942-20322964 CTGAGACAGGATGTATAGGAAGG - Intergenic
1080550379 11:33369267-33369289 CTGAGGCAGCACAATGAGGATGG - Intergenic
1080769593 11:35328204-35328226 CTGAGTCAGTGGGAATAGGATGG - Intronic
1083643447 11:64158201-64158223 TTGAGTCACCAAGGAGAGGATGG + Intronic
1084141510 11:67233780-67233802 CAGAGTCAGCAAGAAGAGAGGGG + Intronic
1084800268 11:71538992-71539014 CTCAGGCAGGATGAAGATGAAGG - Exonic
1085270242 11:75265907-75265929 GGGAGACAGCATGAAAAGGAGGG + Exonic
1086347805 11:85915151-85915173 CTGAGTCAGCTTTAGGGGGAAGG - Intronic
1090901247 11:131033565-131033587 CTGAGTCAGCAGGGGAAGGATGG + Intergenic
1091340189 11:134806155-134806177 CTGGGTCAGCATGGAGAGAAGGG - Intergenic
1092306243 12:7304091-7304113 CACAGACAGAATGAAGAGGAAGG + Intergenic
1095715322 12:45339256-45339278 CTGACTCAGCATGTATGGGATGG - Intronic
1097710506 12:62912452-62912474 CTGAGGCAGAAGGAATAGGAGGG + Intronic
1098083366 12:66813655-66813677 TTGATACAGCATGAACAGGAAGG + Intergenic
1098208160 12:68134625-68134647 CTGAGCCAGCACCAAGAGCATGG + Intergenic
1099215685 12:79850749-79850771 CTAAGACAGCACTAAGAGGATGG - Intronic
1100295694 12:93258825-93258847 TTGTGTATGCATGAAGAGGAAGG - Intergenic
1100935634 12:99661899-99661921 TTCAATCAGCAGGAAGAGGAAGG - Intronic
1101088352 12:101259063-101259085 CTGATTCAGCCTGAAAAGGTGGG + Intergenic
1101201523 12:102441261-102441283 CTGAGTAAGCAAGAAGATAATGG - Intronic
1102717067 12:114983316-114983338 CAGAATCAGCATGGAAAGGAAGG - Intergenic
1103344579 12:120240892-120240914 CTGAGCCAGCAGGAAGAGGGTGG - Intronic
1103443656 12:120980462-120980484 CTGACTTGGCAGGAAGAGGAGGG + Intronic
1105259121 13:18765917-18765939 CTAGGTCAGCATCAAGAAGATGG + Intergenic
1105261797 13:18785236-18785258 CTAGGTCAGCATCAAGAAGATGG + Intergenic
1105264154 13:18801825-18801847 CTAGGTCAGCATCAAGAAGATGG + Intergenic
1106197875 13:27509593-27509615 CAGAGCCTGCATGAAGGGGATGG - Intergenic
1107270180 13:38607043-38607065 CTGAGGCACAATTAAGAGGAAGG - Intergenic
1108164761 13:47680652-47680674 CTGATTCAGTAAGAACAGGATGG + Intergenic
1112156621 13:96824213-96824235 CTAAGTCAGCATGAGGGAGAAGG + Intronic
1113130276 13:107028925-107028947 CTGAGACAGCAGGAAAAGGATGG - Intergenic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1117594728 14:57314702-57314724 ATGAGACAGCATGAGGGGGATGG + Intergenic
1117779898 14:59221730-59221752 CTGAGTCAGCAGGACAAGAAAGG - Intronic
1117911274 14:60640606-60640628 CTAAGTTAGCATGGAAAGGACGG + Intergenic
1117956620 14:61128241-61128263 ATGAGGCAGAATGTAGAGGAAGG - Intergenic
1118721103 14:68594401-68594423 CTGAGGCTTCCTGAAGAGGATGG - Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119582857 14:75803150-75803172 CTCAGGTAGCTTGAAGAGGATGG + Intronic
1121081936 14:91115312-91115334 CTGAGGAAGCAGGAAGGGGAAGG + Intronic
1121696639 14:95918680-95918702 CTGACTCAGGAGGAAGTGGAGGG - Intergenic
1121861669 14:97324433-97324455 CTGAATCAGCAGAAACAGGAAGG - Intergenic
1122364309 14:101185427-101185449 CAGAGTCTGCAAGAGGAGGAAGG + Intergenic
1122964792 14:105117743-105117765 CTGTGACAGCAGGAAGAGCAGGG + Intergenic
1202834298 14_GL000009v2_random:66216-66238 CTAGGTCAGCATCAAGAAGATGG - Intergenic
1124158635 15:27249992-27250014 CTGAGTCAGCACGCACAGGTGGG + Intronic
1125245134 15:37627765-37627787 CTGAGTTACCAGGAAGAAGATGG + Intergenic
1126460091 15:48905605-48905627 CTGACTCTGCATGATGAAGAAGG + Intronic
1127469395 15:59276835-59276857 GTGAGTCAGCATACACAGGAAGG + Intronic
1128765188 15:70247049-70247071 CTGAGTCAAAATAAAGAGGAAGG - Intergenic
1129795603 15:78374014-78374036 CTGTGTCAACATGAGGAGGGAGG - Intergenic
1130843396 15:87722855-87722877 CTGAGACAGGGTGAGGAGGATGG + Intergenic
1133405518 16:5521316-5521338 CTGAGTCTGCATGAATTGCACGG - Intergenic
1134261099 16:12651470-12651492 TAGAGTCTGCATGGAGAGGAAGG + Intergenic
1135229283 16:20690578-20690600 TTGAGACTGCATGCAGAGGAGGG - Intronic
1138079649 16:54077761-54077783 CTGAGTCAGAAGGAAGAGGTAGG + Intronic
1138144385 16:54595645-54595667 CTGACTAAGCATTAAGGGGAGGG - Intergenic
1138578839 16:57926407-57926429 CTGAGTCAAGATGATGAGGCTGG - Intronic
1139449677 16:67019481-67019503 GTGAGTCAGCATGTGAAGGAAGG + Intergenic
1141256035 16:82403348-82403370 CTAACTGAGCTTGAAGAGGATGG - Intergenic
1143226268 17:5306688-5306710 CTGAGTCAGAATCATGAGGTTGG + Intronic
1144727626 17:17509818-17509840 CAGAGCCAGGAAGAAGAGGAAGG - Intronic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1144825185 17:18101785-18101807 CTGAGGCAGCAAGGGGAGGAAGG + Intronic
1147210865 17:38871661-38871683 CTGAGTCAGCGTGAGGAGGTGGG + Intronic
1148140434 17:45324124-45324146 ATGAGACAGCAAGAAGAGGCGGG - Intergenic
1149479634 17:56992319-56992341 CTGAGTCAGCATGAAGAGGAGGG + Intronic
1149481413 17:57006218-57006240 GTGACTCAGCAAGAATAGGATGG + Exonic
1151188447 17:72380541-72380563 CTGAGTATGCATGAAGTGGTGGG + Intergenic
1152164951 17:78697580-78697602 CTGATTCAGATTGAAAAGGAGGG + Intronic
1152307170 17:79527925-79527947 CTGACTCGGCAGAAAGAGGAAGG - Intergenic
1152407489 17:80105909-80105931 CTGTGCCAGCATGATGGGGAGGG + Intergenic
1153100474 18:1462666-1462688 CTGAGGCAGGATGCAGAGAACGG - Intergenic
1154052095 18:10970722-10970744 GTGAGTCAGGAGAAAGAGGAAGG + Intronic
1154411881 18:14146075-14146097 CTGAGTCACCCTCCAGAGGAGGG + Intergenic
1154424245 18:14259736-14259758 CTAGGTCAGCATCAAGAAGATGG - Intergenic
1154431915 18:14314818-14314840 CTAGGTCAGCATCAAGAAGATGG - Intergenic
1156627183 18:38923296-38923318 CTAAGACAGCATGCAGAGAAAGG - Intergenic
1157796998 18:50583793-50583815 CTGATTCAGTGTGAAGAGAAGGG - Intronic
1159340134 18:67124125-67124147 CTGAGTCAACAGGCAGAGAATGG + Intergenic
1159714410 18:71804150-71804172 CTCATTCATCATCAAGAGGATGG + Intergenic
1159904030 18:74074558-74074580 GTGAGTCAGCTGGAAGACGAAGG - Intronic
1159913662 18:74169646-74169668 CTGAATCACCATGAGGAGCAGGG + Intergenic
1162215013 19:9126855-9126877 CAGGAACAGCATGAAGAGGATGG + Exonic
1163449250 19:17365976-17365998 CTGATTCAGCATGAAGAGCAAGG + Exonic
1164801623 19:31081387-31081409 CTCACTCACCATCAAGAGGATGG - Intergenic
1165364703 19:35358416-35358438 CTGAGACTGCATGAGGAGGGAGG + Intergenic
1166326075 19:42051927-42051949 CTGAGTCAGCTTTAGGAGGCTGG - Intronic
1167019515 19:46862953-46862975 CTGAGGCAGCTCCAAGAGGAAGG - Intergenic
1167270476 19:48503035-48503057 TTGGGGCAGGATGAAGAGGAAGG - Intronic
1202638385 1_KI270706v1_random:61476-61498 CTAGGTCAGCATCAAGAAGATGG + Intergenic
925122640 2:1431187-1431209 CTGACTCATCACCAAGAGGATGG - Intronic
926118814 2:10229871-10229893 TTCAGGCAGCATGAAGAGAAGGG + Intergenic
926686701 2:15703803-15703825 CTTACTTAGCATGAAGATGAGGG - Intronic
928182469 2:29079204-29079226 CTGAGTCACCATGTGGAGTAGGG - Intergenic
928193484 2:29195426-29195448 TTTAGTCACAATGAAGAGGAGGG + Intronic
929602274 2:43211825-43211847 CTGAGTGGGCCTGAGGAGGAAGG + Intergenic
929751583 2:44719813-44719835 CTTTGTCAGGTTGAAGAGGAAGG + Intronic
930461361 2:51682048-51682070 CTTTGTCAGCATGAAAATGAAGG + Intergenic
931640189 2:64374957-64374979 CTGAGTCAGCATTTGAAGGAGGG + Intergenic
932385268 2:71326563-71326585 CAGAGGAAGAATGAAGAGGAAGG - Intronic
934493838 2:94780960-94780982 CTAGGTCAGCATCAAGAAGATGG + Intergenic
934494296 2:94784094-94784116 CTAGGTCAGCATCAAGAAGATGG + Intergenic
935128985 2:100247375-100247397 CTCAGGCAGCTTGAGGAGGATGG - Intergenic
935639885 2:105280620-105280642 CTGCGTACTCATGAAGAGGAGGG + Exonic
936095043 2:109524974-109524996 CTGAGTGAAGATGCAGAGGACGG - Intergenic
936639486 2:114296161-114296183 TTGGTTCAGCCTGAAGAGGAGGG + Intergenic
937797995 2:126048182-126048204 CTGAGTTTTCATGAAGATGATGG + Intergenic
940210431 2:151251219-151251241 CTGAGTCAGGAGAAAGTGGATGG - Exonic
941925239 2:170887733-170887755 CTGAGGCAGCCTGAAGACAAGGG + Intergenic
943635880 2:190306412-190306434 GTGAGCCACCATGAAGAAGAAGG + Intronic
946373757 2:219296301-219296323 CGGGGTCAGCATGACGATGACGG + Exonic
946458067 2:219845259-219845281 TTGAGGCAGGATGAGGAGGAGGG + Intergenic
946619741 2:221548131-221548153 CTCAGTCATCACCAAGAGGATGG - Intronic
946675936 2:222159319-222159341 CTGAGATAAAATGAAGAGGAAGG - Intergenic
946812958 2:223545842-223545864 TTTGGTCAGCATGATGAGGATGG - Intergenic
946844574 2:223848012-223848034 CTCAGTCAGGATGAGGATGATGG + Intergenic
947590631 2:231383188-231383210 CTAACTCAGCATGGAGGGGAGGG + Intergenic
949025662 2:241766078-241766100 CTGAGTGAGTAGGAAGAGGGGGG + Intronic
1169090903 20:2860873-2860895 CTGAGTGGGAATGAAGTGGACGG + Intronic
1171045219 20:21804347-21804369 CTGAGTCATGGTGAAGAAGATGG - Intergenic
1171189944 20:23151586-23151608 CTAAGCCAGCATGAACAGGCAGG + Intergenic
1171476136 20:25410468-25410490 CTTAGTCAGCCTGCAGAGGCTGG + Intronic
1171504506 20:25623035-25623057 CTGATGAAGCATGAAGAGGACGG + Intronic
1173125073 20:40328965-40328987 CTGAATCAGAATGGGGAGGAAGG + Intergenic
1173154216 20:40594230-40594252 CACAGTCAGGAGGAAGAGGAAGG + Intergenic
1173630434 20:44509979-44510001 CTGAATGAGGATGAAGAGGGCGG + Exonic
1174753948 20:53139929-53139951 ATGAGTGAACATAAAGAGGATGG - Intronic
1174846443 20:53947934-53947956 CAGGGTTAGCATGAAGATGAAGG - Intronic
1176117385 20:63438993-63439015 ATTTGTCAGCATCAAGAGGAAGG + Intronic
1176233775 20:64044905-64044927 CTGACTCAGCAGGAGGAGGGTGG + Intronic
1176845125 21:13870944-13870966 CTAGGTCAGCATCAAGAAGATGG + Intergenic
1176847853 21:13890501-13890523 CTAGGTCAGCATCAAGAAGATGG + Intergenic
1176849226 21:13900260-13900282 CTAGGTCAGCATCAAGAAGATGG + Intergenic
1176861151 21:14012257-14012279 CTGAGTCACCCTCCAGAGGAGGG - Intergenic
1176886923 21:14267836-14267858 CTGTCTCAGCATAGAGAGGAAGG - Intergenic
1177079379 21:16619743-16619765 CAGAGAAAGCATGAAGAGCAAGG + Intergenic
1177219859 21:18178697-18178719 CCTACTCAGCATGAAGAGGGTGG - Intronic
1179052779 21:37903026-37903048 CGCAGACAGCATGGAGAGGAAGG - Intronic
1179080397 21:38165595-38165617 GTGAGACAGCATGATGAGAAAGG - Intronic
1179089935 21:38255650-38255672 TTGAGTCAGCAGGGAGAGGGGGG + Intronic
1179550265 21:42139408-42139430 GTGAGACAGCACCAAGAGGATGG + Intronic
1179829850 21:43989650-43989672 CTGTGCCAGCATGGAGGGGAGGG + Intergenic
1180363580 22:11920412-11920434 CTAGGTCAGCATCAAGAAGATGG - Intergenic
1181839043 22:25638748-25638770 CTGAATCAGCAGGCAGAGAAGGG - Intronic
1182411808 22:30193564-30193586 CTGAGGCCATATGAAGAGGAAGG + Intergenic
1182509237 22:30807247-30807269 CCCAGACAGCAAGAAGAGGAAGG - Intronic
1184635896 22:45831020-45831042 ATGAGTCAGCTTTAAAAGGAAGG + Intronic
1184930919 22:47680786-47680808 CTGAGAAAGCTTAAAGAGGAGGG + Intergenic
949098860 3:119392-119414 CTGAGACAGAGTGAAGAGCAAGG + Intergenic
949538868 3:5016784-5016806 GTGAGTCAGGAGGCAGAGGAGGG + Intergenic
950064212 3:10098560-10098582 GTGATTCAGCATCTAGAGGAGGG - Intronic
950963827 3:17132196-17132218 CAGTGTCAGCAGGAAGCGGAGGG - Intergenic
951021580 3:17786677-17786699 CTGAGTCCTCATGTGGAGGAAGG - Intronic
951613254 3:24516135-24516157 TTCAGCCATCATGAAGAGGAGGG - Intergenic
953472509 3:43179170-43179192 CCGAGTCAGCATTACGAGGCAGG + Intergenic
954464594 3:50647032-50647054 CTGAGTCTGGGAGAAGAGGATGG + Intronic
954692417 3:52402606-52402628 CTGAGCCAGCATGGAGATAAAGG + Exonic
954968364 3:54630484-54630506 GTGAGTCTGCAAGAGGAGGATGG - Intronic
956524731 3:70145073-70145095 CTGGGTAAGAATGAAGAAGAAGG - Intergenic
958542327 3:95494766-95494788 CTGAGTTATCATGAAAAAGAAGG - Intergenic
959547988 3:107620538-107620560 CTTTAGCAGCATGAAGAGGATGG + Intronic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
961077702 3:123997260-123997282 CAGAGGTAGCAGGAAGAGGAGGG - Intergenic
961306865 3:125964022-125964044 CAGAGGTAGCAGGAAGAGGAGGG + Intergenic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
963223267 3:142834052-142834074 ATCAGTCAGCAGGAAAAGGATGG - Intronic
963346193 3:144098984-144099006 CTGAGTCTGCAGGGACAGGAGGG - Intergenic
966476824 3:180358375-180358397 CTGAGTCAAGATGAGGAGGCAGG - Intergenic
969293473 4:6255319-6255341 CTGAGTCACCATGTGGAGGAAGG - Intergenic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
973368620 4:49227819-49227841 CTAGGTCAGCATCAAGAAGATGG + Intergenic
973392429 4:49567606-49567628 CTAGGTCAGCATCAAGAAGATGG - Intergenic
973692760 4:53455349-53455371 ATGAGGAAGCTTGAAGAGGAAGG - Intronic
974310399 4:60200902-60200924 CTGAATCAGAATGAAGTGGAGGG - Intergenic
974587821 4:63902330-63902352 CTCACTCATCATAAAGAGGATGG + Intergenic
979107611 4:116707084-116707106 GTGATCCAGCATTAAGAGGAGGG + Intergenic
979348052 4:119612315-119612337 CTCACTCATCATGAAGGGGATGG - Intronic
979930796 4:126627853-126627875 CTCAGTCATCATGAAGGGGAGGG + Intergenic
979943343 4:126791927-126791949 CTGATTCAGCCTGATCAGGATGG - Intergenic
979994897 4:127420009-127420031 CTGCTTCAGCATCAAGAGGTTGG + Intergenic
981095582 4:140776034-140776056 GAGAGTCAGCATGAAGAGCGGGG - Intergenic
984912623 4:184688567-184688589 CTGAGTCAGAAAGAGCAGGAAGG - Intronic
985385051 4:189436751-189436773 CTGAGAAGCCATGAAGAGGAGGG - Intergenic
1202765719 4_GL000008v2_random:147334-147356 CTATGTCAGCATCAAGAAGATGG + Intergenic
986399154 5:7362649-7362671 CTGTTTCAGAATGAAAAGGAAGG + Intergenic
986461011 5:7972296-7972318 CTCATTCAGCACCAAGAGGATGG - Intergenic
986650980 5:9963144-9963166 CTGAGTCACCATGTTGATGATGG - Intergenic
987590941 5:19925198-19925220 ATGAGTCTTCCTGAAGAGGAGGG + Intronic
987720826 5:21630114-21630136 CTGATACAGCAGGAAGAGAAAGG + Intergenic
988932265 5:36047994-36048016 CTGAGTGAGCAGGAAGAGTTGGG - Intronic
989112751 5:37923107-37923129 CACAGTGAGAATGAAGAGGAAGG - Intergenic
992894716 5:81236006-81236028 CTGTGCCAGTGTGAAGAGGAAGG - Intronic
993518726 5:88871327-88871349 ATAAGTCTGCATGAAGATGATGG - Intronic
994771520 5:103987910-103987932 CTGATTCAGAAAGTAGAGGATGG + Intergenic
994833273 5:104813584-104813606 CTGAGTAAGTTGGAAGAGGAAGG - Intergenic
995275897 5:110277463-110277485 ACAAGTCAGCATGAAGGGGATGG + Intergenic
995390164 5:111632078-111632100 CTAAGTGAGGATGCAGAGGAAGG - Intergenic
997735019 5:136206800-136206822 CTGAGGCTGCAGGAAGAGGATGG - Intergenic
997930626 5:138069764-138069786 TTGAGTCAGTAGGAAGAAGAGGG - Intergenic
998374836 5:141683310-141683332 CTGAGGCAGCTGGAAGAGGTGGG - Intergenic
998885708 5:146691740-146691762 GTGAGTGAGCAGGGAGAGGATGG - Intronic
1000304467 5:159983114-159983136 CTGGGTCAGGTTGAAGGGGAAGG - Intergenic
1001323202 5:170699834-170699856 ATGAGTCAGCAAGGAGAGGAAGG + Intronic
1001915175 5:175554511-175554533 CTGAGTCATCATCATAAGGAAGG + Intergenic
1002085887 5:176775067-176775089 CTGAGTCATCATGAATGAGAAGG - Intergenic
1002653075 5:180718211-180718233 CTGAATCAGCATTAACAGAAAGG + Intergenic
1003762761 6:9198905-9198927 GTGACTCAGCAAGAAGAGGGTGG - Intergenic
1006909620 6:37555512-37555534 CTCAGGGAGCATGAAGGGGATGG - Intergenic
1007092739 6:39194245-39194267 CTCAGTCACCATGAATACGAAGG + Exonic
1007597944 6:43063115-43063137 CTGCGGCAGTATGATGAGGATGG + Exonic
1008690751 6:53975975-53975997 CTAAGTCATGATGAAGAGAAAGG + Intronic
1009796248 6:68471979-68472001 CTGACTCAGCATGCAGATCATGG - Intergenic
1010761722 6:79731703-79731725 GTGAGTCTGCATGAAGTGTAGGG + Intergenic
1010790199 6:80055092-80055114 ATGAGTAAGTATGAAGAGCATGG - Intergenic
1011698854 6:89936904-89936926 CTGTGTCAGGCTGAAGAAGAGGG - Intronic
1012716649 6:102681810-102681832 CTGAATCAGAATTTAGAGGAGGG + Intergenic
1013299213 6:108787477-108787499 TTGAGACAGCATAAAGAGAAAGG - Intergenic
1014826757 6:126055762-126055784 CTGAGGAAGCATGAAAAAGATGG - Intergenic
1016404593 6:143716830-143716852 CTGGGTGAGCAGGGAGAGGAGGG + Intronic
1016873236 6:148839272-148839294 CTGAGTCAGCATAATCAGGAAGG + Intronic
1017051913 6:150401380-150401402 CTGAGTAATGAAGAAGAGGAAGG + Exonic
1018315082 6:162548889-162548911 CTTAGTCAGCAGGAAGATAAGGG - Intronic
1018748809 6:166783339-166783361 CTGAGCTACCCTGAAGAGGAAGG + Intronic
1020921227 7:14267317-14267339 CTGAATCTACATGAAGAAGAAGG + Intronic
1020969663 7:14919773-14919795 CTCACTCATCATGAAGGGGATGG - Intronic
1021371006 7:19846733-19846755 CAGAGACAACATGAAGAAGATGG + Intergenic
1021980144 7:26046246-26046268 CTGAGTCAGGATACAGAGTATGG + Intergenic
1022332852 7:29396798-29396820 CTGAGCCAGGTTGGAGAGGATGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023512831 7:40971255-40971277 CCCACTCAGCATGAAGAGGATGG + Intergenic
1023879318 7:44309391-44309413 CTGAGCCAGCAGGAGCAGGAGGG + Intronic
1024704927 7:51946797-51946819 CTGAGTCTACATGGAGAGGTAGG - Intergenic
1026451255 7:70531648-70531670 CTGACTCATCACCAAGAGGATGG + Intronic
1027182181 7:75948542-75948564 GACAGGCAGCATGAAGAGGAGGG + Intronic
1029192500 7:98781685-98781707 CTGGTTCAGCAGGAAGAGGCTGG + Intergenic
1029919843 7:104251589-104251611 CTGAGGAAGAATGAAGAGGGAGG + Intergenic
1031145960 7:117996757-117996779 CTGGGGCAGCATGAAGACAATGG + Intergenic
1031959134 7:127973087-127973109 CAGAGTGGGAATGAAGAGGAAGG + Intronic
1032932156 7:136685685-136685707 CTCTGTCAGCCTGAAGATGAAGG + Intergenic
1034139292 7:148801496-148801518 CTGAGTCGGCATGGAGAGCATGG + Intergenic
1034374945 7:150633932-150633954 CAGAGTCAGCTTGCAGAAGATGG - Intergenic
1034524466 7:151648444-151648466 CGGAGTCAGCATGAAGGGCTGGG + Intronic
1035312960 7:157981936-157981958 CTGAGTCATAAAGATGAGGAGGG + Intronic
1035901396 8:3461580-3461602 CTCCATCAGCAGGAAGAGGAAGG + Intronic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1038964083 8:32551843-32551865 CTGAATCAGTATGAAGAGGCTGG - Intronic
1039028086 8:33279979-33280001 CAAAGACAGCATGATGAGGATGG - Intergenic
1039103842 8:33969611-33969633 CTTTGTCAGCATTAAGAAGAAGG - Intergenic
1039125079 8:34192049-34192071 ACGATTCAACATGAAGAGGACGG - Intergenic
1041534363 8:58909410-58909432 CTGATTCAGCATGTACAGGATGG - Intronic
1042488835 8:69376521-69376543 GTGAGACAGCATGAAGAGGATGG - Intergenic
1043498559 8:80830251-80830273 CTGAGGCAGAATGGAAAGGAAGG + Intronic
1044592069 8:93922945-93922967 CTGGGTGTGCAGGAAGAGGACGG + Exonic
1044601683 8:94011648-94011670 CTGAATCAGAATGGAGAGAAGGG + Intergenic
1047885106 8:129241454-129241476 CTGTGACAGTCTGAAGAGGAAGG + Intergenic
1048224017 8:132567548-132567570 ATGAGGCAGAAGGAAGAGGAAGG - Intergenic
1048651735 8:136485626-136485648 CTGAGACAGCACTAAGGGGATGG + Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048919288 8:139213360-139213382 CTGAGAGAGAAGGAAGAGGAGGG - Intergenic
1050507847 9:6366016-6366038 CTGAGTCGGCCTGAAGAGCCAGG - Intergenic
1050537010 9:6639389-6639411 CTGAGTCGCCATGAAGAAGATGG + Intronic
1051027423 9:12630111-12630133 CTGAAGCAGCATGAATAGGCAGG + Intergenic
1051192078 9:14523804-14523826 CTCAGTCAGTATGAAGTGGTAGG - Intergenic
1051432007 9:16988797-16988819 CATAGGCAGCATGAGGAGGATGG + Intergenic
1052873723 9:33535231-33535253 ATGAGTCACCATGAAGAGTGAGG - Intronic
1053502368 9:38609532-38609554 ATGAGTCACCATGAAGAGTGAGG + Intergenic
1053663235 9:40299043-40299065 CTAAGTCAGCATCAAGAAGATGG - Intronic
1053664692 9:40309130-40309152 CTAAGTCAGCATCAAGAAGATGG - Intronic
1053913274 9:42926447-42926469 CTAGGTCAGCATCAAGAAGATGG - Intergenic
1053913736 9:42929574-42929596 CTAAGTCAGCATCAAGAAGATGG - Intergenic
1054374955 9:64442496-64442518 CTAGGTCAGCATCAAGAAGATGG - Intergenic
1054375357 9:64445267-64445289 CTAAGTCAGCATCAAGAAGATGG - Intergenic
1054519924 9:66067154-66067176 CTAAGTCAGCATCAAGAAGATGG + Intergenic
1054521379 9:66077242-66077264 CTAAGTCAGCATCAAGAAGATGG + Intergenic
1054757541 9:68974168-68974190 CTTAGCAAGAATGAAGAGGAAGG - Intronic
1056186786 9:84143140-84143162 CTCAGGCACCATGAAGAAGAGGG + Intergenic
1056567997 9:87791810-87791832 CTGATTCAGCCTCAAGAGTAAGG + Intergenic
1056655576 9:88505989-88506011 CTAGGTCAGCAAGAGGAGGAGGG - Intergenic
1057089577 9:92245106-92245128 GTGGGGCAGCTTGAAGAGGAGGG - Intronic
1057677371 9:97146537-97146559 CTAGGTCAGCATCAAGAAGAAGG + Intergenic
1058977167 9:110136036-110136058 CTGACTCATAATTAAGAGGAAGG - Intronic
1058989732 9:110243231-110243253 CTGAGTAAGCAGGAAAATGATGG - Intergenic
1060378563 9:123142225-123142247 ATGAGACAGCATTAAGGGGATGG - Intronic
1060917965 9:127402644-127402666 CTGAGTCAGCAGGAAGCGCGGGG - Exonic
1203546469 Un_KI270743v1:132224-132246 CTAGGTCAGCATCAAGAAGATGG + Intergenic
1186194530 X:7097883-7097905 CTAAGTCAGCCTGAGGAGGAAGG + Intronic
1186473302 X:9837774-9837796 CTGAGCCAGCAAGGACAGGAGGG - Intronic
1187583317 X:20632537-20632559 CTGATTCATCAGGAAGAGGTTGG - Intergenic
1189057793 X:37716858-37716880 CTGAGGCAGGATGATAAGGAAGG + Intronic
1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG + Intergenic
1192264172 X:69527575-69527597 CTGTTTCAGCTTCAAGAGGACGG - Intronic
1193406572 X:81108331-81108353 CTAAGACAGGAGGAAGAGGAGGG - Intergenic
1194230389 X:91315602-91315624 CTGAGTGACCATGAAGAACAGGG + Intergenic
1195387337 X:104325559-104325581 ATCAGTGAGCATGAAAAGGAAGG - Intergenic
1196023403 X:111013986-111014008 CTGACACAACATGAAGAGGCAGG - Intronic
1197600531 X:128521825-128521847 CTGAAACAGCATGTAGAGGATGG + Intergenic
1199802805 X:151268235-151268257 CTCAGTCAGGATGGAGAGCAAGG + Intergenic
1201644216 Y:16210022-16210044 CTGAGTCACTATAAACAGGAAGG + Intergenic
1201658599 Y:16375299-16375321 CTGAGTCACTATAAACAGGAAGG - Intergenic
1202114668 Y:21459845-21459867 CTGACTCAGCAGAAATAGGAGGG + Intergenic