ID: 1149480824

View in Genome Browser
Species Human (GRCh38)
Location 17:57001810-57001832
Sequence CCCAGCAGCCTAGGTTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 205}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149480824 Original CRISPR CCCAGCAGCCTAGGTTTCAC TGG Intronic
900606282 1:3525082-3525104 CCCAGCTGCATTGGTTTCCCAGG - Intronic
901606499 1:10463319-10463341 CCCAGCAGCCGCGGCTTCAGTGG + Intronic
901661472 1:10800452-10800474 CCCAGCAGAGGAGGTTGCACAGG + Intergenic
903876483 1:26477787-26477809 CCCAGCAGCCTGTGTTTCACTGG + Intergenic
904004810 1:27358161-27358183 CCCAGGAGCCTTGGTCTCACCGG + Exonic
907763892 1:57389287-57389309 CCCAGCTGACAAGGTTTCAATGG + Intronic
910132505 1:83925360-83925382 CCCAGAAGCCTAGGAATCATAGG + Intronic
910874685 1:91867443-91867465 CCCAGCAGCCTTGGTTTCCTTGG + Intronic
911523338 1:98954859-98954881 CCAAACAGCCTAGATTTCAAAGG - Intronic
912207929 1:107528541-107528563 CACAGCAGCTTAGCTTTTACTGG + Intergenic
915512330 1:156393008-156393030 TCCAGCAGCCTGGGATTCAGTGG + Intergenic
916633098 1:166638117-166638139 CCCAGCAGCCTTGGATTCCCAGG + Intergenic
917915212 1:179694577-179694599 CCCAGCAGGCTAAGATCCACTGG + Intergenic
922223674 1:223627420-223627442 CCCAGCTGCCTGGGTTTCTGGGG + Intronic
924124605 1:240837258-240837280 CACAGCAGGCCAGGTGTCACAGG - Intronic
924568448 1:245217437-245217459 CCCAGCAGCGGAGGTTGCAGCGG - Intronic
1067845138 10:49713555-49713577 CCCAGGAGCTTGGCTTTCACAGG + Intergenic
1070694538 10:78552200-78552222 CACAGCAGCCTGAGCTTCACCGG + Intergenic
1071314548 10:84381601-84381623 CTCAGCTCCCAAGGTTTCACTGG - Intronic
1073206847 10:101774211-101774233 CCCAGCCGCCTGGGTTCCCCAGG + Intronic
1073350907 10:102819112-102819134 CCCACCAGCCTGGGGTTCAATGG - Intergenic
1074753516 10:116608718-116608740 CCCAGCAGCCTGGCTTACAGAGG - Intronic
1075246319 10:120825183-120825205 CCCCGCAACCTGAGTTTCACTGG - Intergenic
1077142124 11:1029344-1029366 CCCAGCGGCCCAGGGTGCACCGG + Exonic
1077231331 11:1459359-1459381 CCCAGCAGCCCAGATGTCCCCGG + Intronic
1080214408 11:29824923-29824945 GCCAGGAGCCTATGTTACACAGG + Intergenic
1080427016 11:32164747-32164769 CGCTGCAGCTTAGGTTTCAATGG - Intergenic
1081317738 11:41650996-41651018 CCCAGCAAGCTAAGATTCACTGG - Intergenic
1083385530 11:62306567-62306589 CCCAGCAAGCTAAGTTTCACTGG - Intergenic
1088211939 11:107466367-107466389 CCCAGCAAGCTAAGATTCACTGG - Intergenic
1088648718 11:111938390-111938412 ACTAACAGCCTAGGTTTCCCTGG - Intronic
1089303947 11:117515277-117515299 CCCTGTAGCCTGGTTTTCACAGG + Intronic
1089699752 11:120237481-120237503 TCCAGCAGCCTAGGATTCTGGGG - Intronic
1089766039 11:120766365-120766387 CCCAGCAAGCTAGGATCCACTGG - Intronic
1090424156 11:126595364-126595386 CCCAGCAGGCTAGTTGTCCCAGG + Intronic
1091694324 12:2617727-2617749 ACCAGCTGCCTTGTTTTCACTGG + Intronic
1091712149 12:2749665-2749687 CCCAGCAGGCTAAGGTCCACTGG + Intergenic
1092638884 12:10481900-10481922 CCCAGCAAGCTAAGATTCACTGG + Intergenic
1094021211 12:25916687-25916709 CACTGCAGCCTTGGTTTCTCAGG + Intergenic
1096941841 12:55355456-55355478 CCCAGCAGGCTAAGATACACTGG + Intergenic
1097375826 12:58841291-58841313 CCCAGCAACCTAAGATCCACTGG - Intergenic
1097683504 12:62671024-62671046 CCCAGCAGCAAAGGCTTCAAAGG + Intronic
1098867554 12:75780250-75780272 CCCAGCTGCCTACATTTCTCTGG + Intergenic
1100544100 12:95585063-95585085 CACTGCAGCCTAGCTCTCACAGG - Intergenic
1102281632 12:111623196-111623218 CCCTGCAGCCTCTGTTTCCCAGG + Intergenic
1103985850 12:124767095-124767117 CCCAGCAGCCCGGGTCTCTCTGG - Intergenic
1108395922 13:49991449-49991471 CACTGCAGCCTAGGTCTCATGGG - Intergenic
1109328648 13:60900564-60900586 CCCAGCAAACTAAGATTCACTGG + Intergenic
1110942026 13:81362773-81362795 CCCAGCAAACTAAGATTCACTGG + Intergenic
1113582179 13:111437558-111437580 CCCAGCAGCCTGGGGGTCAGGGG - Intergenic
1113668892 13:112161817-112161839 CCCCGCAGCCCAGGTTTGTCGGG + Intergenic
1114341937 14:21754304-21754326 CCCAGCAAGCTAAGATTCACTGG + Intergenic
1115315163 14:32017432-32017454 CCCTGCAGCCTTGATTTCCCTGG - Intronic
1116139491 14:40972505-40972527 CCCAGCAGTCTGAGTTTCACAGG + Intergenic
1120450045 14:84655482-84655504 CCCAGCAAGCTAAGATTCACTGG - Intergenic
1120955836 14:90080903-90080925 CCAAGCACCCTAGGATGCACAGG - Intronic
1124686838 15:31790220-31790242 CCCTGCCGCCTAGTTTTTACAGG - Intronic
1129126762 15:73448226-73448248 CCCAGCAACCTAAGATCCACTGG + Intronic
1131607680 15:93926055-93926077 CCCAGCAGCCTGGCTGTCATGGG - Intergenic
1132044541 15:98552318-98552340 CCCAGCAGCAGAGGTCTCTCAGG - Intergenic
1132566941 16:627872-627894 CCCAGCTGCCTGGGCTTGACCGG + Exonic
1132940782 16:2507080-2507102 CCCAGCAGCCTCGGTCTCACTGG - Intronic
1134215979 16:12317219-12317241 GCCAGCAGCCAAGCCTTCACAGG - Intronic
1138623460 16:58230567-58230589 CCCTTCAGGCTAGGTTTCCCAGG - Intergenic
1140214533 16:72996719-72996741 TCCAGCAGCTTAGGTTTACCAGG - Intronic
1145852299 17:28112341-28112363 CCCAGCAGCTTCGTTGTCACAGG - Intronic
1147389529 17:40100649-40100671 GCCAGCAGCCCAGGGTTCCCGGG + Exonic
1147886979 17:43690893-43690915 CCCAGCAGCCAAGGTGGCAGAGG + Intergenic
1149480824 17:57001810-57001832 CCCAGCAGCCTAGGTTTCACTGG + Intronic
1149491350 17:57086653-57086675 TCCAGCAGCCTAGATTTCACTGG - Intronic
1150540509 17:66093264-66093286 CACTGCAGCCTACGTCTCACGGG - Intronic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1152596532 17:81240338-81240360 CCCAGCAGCCTTGGATCCAGGGG + Intronic
1153216026 18:2821729-2821751 CCCAGAAGCCTTGGTTCCAAAGG - Intergenic
1156781354 18:40854371-40854393 CCTAGCAGCCAAGGTTTGGCTGG + Intergenic
1157644889 18:49257816-49257838 CCCTTCAGCCTAGGCTGCACAGG - Intronic
1159570900 18:70110788-70110810 CCCAGCAAACTAAGATTCACTGG + Intronic
1159758688 18:72397794-72397816 CACAGCACTTTAGGTTTCACGGG - Intergenic
1160466662 18:79083318-79083340 CCCAGCAAGCTAAGATTCACTGG - Intronic
1162083292 19:8232795-8232817 CCCTGCAGCCTAGATCTCCCAGG + Intronic
1162211361 19:9094746-9094768 CCCAGCCGCAGAAGTTTCACGGG + Intergenic
1164578349 19:29419072-29419094 CACAGGAGCCTAGATTTCCCTGG - Intergenic
1164606033 19:29598743-29598765 CCCTGCAGCCCAGGTACCACTGG - Intergenic
1166503338 19:43356426-43356448 CCCAGCAGCCTTGCCTGCACAGG + Intronic
1166507116 19:43378335-43378357 CCCAGCAGCCTTGCCTGCACAGG - Intergenic
1167769436 19:51505200-51505222 TCCAGCAGCCCAGGATTCAAGGG + Intergenic
924992049 2:320652-320674 ACCAGCAGGCTAGGTTTGACTGG - Intergenic
934871811 2:97872971-97872993 CCCAGCAAACTAAGATTCACTGG + Intronic
935320841 2:101887543-101887565 CCCAGCATCCAATGTTTCATGGG + Intronic
935325827 2:101935896-101935918 CCCAGCAAGCTAAGATTCACTGG + Intergenic
936927970 2:117757402-117757424 CCCAGCACCTTAGTTTGCACAGG + Intergenic
938236351 2:129709711-129709733 CCCAGAAGCCAAGGTGTCAGTGG - Intergenic
940964539 2:159822401-159822423 CCCAGCAGCTTTGTTTACACTGG - Intronic
942745113 2:179222822-179222844 TGCAGGAGCCTAGGTTTCACAGG - Intronic
943381169 2:187150258-187150280 CCCAGAAGCCTAGGATTCAAGGG - Intergenic
946008200 2:216543326-216543348 CCCAGCTGCCCAGGCTGCACGGG + Intronic
946211648 2:218152005-218152027 CCCAGCAGCCTTAGTTTCTTAGG + Intergenic
947991547 2:234491979-234492001 GTCAGCAGCCTAGGTTTTAGTGG + Intergenic
1168998427 20:2149291-2149313 CCCAGCAGTCTTGATTTCTCTGG - Intronic
1169495848 20:6114140-6114162 CCCAGCAGCCAAGGATTGTCAGG + Intronic
1169819689 20:9696256-9696278 ACCATCAGCATAGGTATCACTGG + Intronic
1170997872 20:21382036-21382058 TCCAGCAGCAAAGGTTTGACAGG + Exonic
1172750008 20:37244167-37244189 CCAAGCAGCCAGGGTGTCACTGG + Intergenic
1172940208 20:38648984-38649006 CCCAGAGGCGTCGGTTTCACTGG - Intronic
1175086279 20:56461797-56461819 CTCAGCAGCCAGGGTTTTACTGG + Intergenic
1175182775 20:57160367-57160389 CCCAGCAGGCTGGATGTCACTGG + Intergenic
1176364138 21:6022415-6022437 CCCAGCAGCTCAGGTTTCCAGGG + Intergenic
1176367622 21:6043422-6043444 TCCAGCAGCCCAGGGTTCGCAGG + Intergenic
1177042711 21:16133106-16133128 CCCAGCAAGCTAAGATTCACTGG - Intergenic
1178263096 21:31117803-31117825 ACCAGCAGCGTCGGTGTCACTGG - Intergenic
1179755897 21:43495120-43495142 TCCAGCAGCCCAGGGTTCGCAGG - Intergenic
1179759380 21:43516130-43516152 CCCAGCAGCTCAGGTTTCCAGGG - Intergenic
1179941049 21:44638996-44639018 CCCAGCAGCCCAGTATTCATGGG + Intronic
1181745447 22:24952675-24952697 CCCAGCAGGCTAGGCTGCGCGGG + Intergenic
1183742187 22:39674934-39674956 CCCAGCAGCCTTGGTATAAAGGG + Intronic
1185168997 22:49281282-49281304 CCCAGCAGCCCAGCACTCACAGG - Intergenic
950107657 3:10398515-10398537 CCCAGCAGCCCAGGCTTCACGGG + Intronic
950992020 3:17449462-17449484 CCCAGCAACCTAAGATCCACTGG + Intronic
951347240 3:21561058-21561080 CCCAGCAGGCTAAGATCCACGGG - Intronic
954417381 3:50399916-50399938 CCCACAAGCCTTGGTATCACTGG + Intronic
954699487 3:52443840-52443862 CCCAGCAGACTGGGCTTCCCAGG + Intronic
954888545 3:53900862-53900884 CCCAGCTGCCTAGCCCTCACAGG - Intergenic
956065973 3:65397630-65397652 CCCAGCAGCCTAGGCAACATAGG - Intronic
956732528 3:72209810-72209832 CCCACCAGCCTTGGTCTCAGTGG + Intergenic
958137713 3:89518381-89518403 CCCTGCAGCCTTGGTCTCCCAGG + Intergenic
961377929 3:126479268-126479290 CCCATCAGCCCAGGTATCGCTGG + Intergenic
962006264 3:131352832-131352854 CCCATCATCCTAGGTTTCCCAGG - Intergenic
963480629 3:145868665-145868687 CCCAGAAGCTTAAGTTTCAATGG - Intergenic
967087582 3:186108853-186108875 CCCAGCCGGCTAGAGTTCACGGG - Intronic
968947003 4:3670428-3670450 CACAGCAGCCTCTGTCTCACAGG - Intergenic
969137192 4:5039389-5039411 CACATTAGCCTAGGTCTCACAGG + Intergenic
971913008 4:32821173-32821195 CCCTGCAGCCTTTGTTTCCCAGG + Intergenic
973660896 4:53105414-53105436 CCCAGCATGCTAGGATCCACTGG + Intronic
974553235 4:63407791-63407813 CACTGCAGCCTTGGTTTCCCGGG - Intergenic
976370801 4:84286160-84286182 CCCAGCAGGCTAAGATCCACTGG + Intergenic
979787453 4:124734019-124734041 CCCTGCAACCTAGGCTTCCCAGG - Intergenic
980243094 4:130202273-130202295 GCCAGCAGCCTGGGTGCCACAGG + Intergenic
981087388 4:140698229-140698251 TCCAGGAGCCTAGGTTACACTGG + Intronic
982306032 4:153931877-153931899 CCAAGCAGCCTAGGGCTCAGTGG + Intergenic
983445090 4:167840438-167840460 CCCAGCAGCCTGGATCTCAGTGG - Intergenic
986053861 5:4116449-4116471 CGCAGCACCCTACGTTTCTCTGG - Intergenic
986680676 5:10230742-10230764 CCCAGGAACCCCGGTTTCACTGG + Intronic
987071551 5:14341798-14341820 CTCAGAAGCCAAGGTTTCCCAGG + Intronic
987245969 5:16049173-16049195 CTCAGTAGCCTCGGTTTCATTGG - Intergenic
988684345 5:33513267-33513289 CCCTGAAGCCCAGGTTTCAGAGG - Intergenic
988730437 5:33967469-33967491 CCCAGCAGCATTGGTGTCAGTGG - Intronic
990332103 5:54738420-54738442 CCCAGCAGCCTGGTTTTAAGAGG - Intergenic
990745863 5:58959000-58959022 CCCAGCAAGCTAAGATTCACTGG - Intergenic
993081117 5:83302121-83302143 CCCAGCAAGCTAGGATCCACTGG - Intronic
993726962 5:91380291-91380313 GCCAGCAGGCTAGGTTGCGCGGG - Intronic
993885759 5:93412991-93413013 CTCAGCAGCATAGGTTTCCAGGG - Intergenic
995050376 5:107696684-107696706 CCACGCAGCCCAGGTTTCTCTGG + Intergenic
995749677 5:115441137-115441159 CACAGCAGCTTAGGTTACAGAGG + Intergenic
997840351 5:137234085-137234107 CCCAGCTGCCCAGGTGTCTCTGG + Intronic
997976816 5:138445831-138445853 GCCAGTAGCCTAGGTGTCTCAGG + Exonic
999047341 5:148483194-148483216 CCCAGGGGCCTAAGTGTCACTGG + Exonic
999660404 5:153856613-153856635 CCCACCATCCTGGGTTTCCCTGG - Intergenic
999976449 5:156916486-156916508 ACCAGCAGCCTCCGTGTCACTGG - Intergenic
1000334168 5:160229549-160229571 CCCAGCAGCATGGCTTTCACCGG + Exonic
1003713516 6:8619725-8619747 CCCAGCAACCTAAGATCCACTGG - Intergenic
1004545448 6:16594252-16594274 CCCATCAGCATAAGTTTCCCTGG + Intronic
1005780476 6:29186687-29186709 CCCACCACTCTAGGTTCCACTGG - Intergenic
1006074965 6:31526338-31526360 CCCAGGAGCCAAGGTTACAAGGG + Intergenic
1008896849 6:56566108-56566130 CCCAGCAAGCTAGGATCCACTGG - Intronic
1009536665 6:64896678-64896700 CCCAGCAACCTAAGATCCACTGG + Intronic
1009959517 6:70501406-70501428 CCCAGCAAGCTAGGAATCACTGG - Intronic
1011137410 6:84115487-84115509 CCCAGCAGGCTAAGTTCCACTGG - Intergenic
1011340311 6:86306797-86306819 CCCAGCAGGCTAAGATCCACTGG - Intergenic
1013956908 6:115852529-115852551 CCCAGCAAGCTAAGATTCACTGG + Intergenic
1013964207 6:115935576-115935598 CCCAGCAAGCTAAGATTCACTGG + Exonic
1014113376 6:117645848-117645870 CCCAGCAAGCTAAGATTCACTGG + Intergenic
1016638691 6:146324171-146324193 CCCAGCAGCTTTGTTTACACTGG + Intronic
1018419806 6:163631292-163631314 CCCAGCTTCCTTGGTCTCACTGG + Intergenic
1020140134 7:5607348-5607370 CCCTGCAGCCTAGGATGCAAAGG - Intergenic
1021328674 7:19307203-19307225 CCCAGCACTCTAGGTTGCATCGG + Intergenic
1021475816 7:21059360-21059382 ACCAGCAGCCTAGGAGCCACAGG - Intergenic
1022440361 7:30427975-30427997 CCCAGCAGCCTGGGAAGCACTGG - Intronic
1022505841 7:30908283-30908305 CCCAGCCTCCTAGGGCTCACTGG + Intergenic
1023051762 7:36258735-36258757 CCCAGCAGGCTAAGATCCACTGG - Intronic
1024308784 7:47950204-47950226 CCCAGCAGGCAGGGTTGCACAGG - Intronic
1024479476 7:49849178-49849200 CCCCACAGCCGAGGCTTCACGGG - Intronic
1029494276 7:100888948-100888970 CCCAGCAGCCTGTAGTTCACTGG + Exonic
1029985128 7:104916067-104916089 GCTAGCAGCCTTGGTTTCTCAGG - Intergenic
1030703084 7:112662474-112662496 CCCAGCAGGCTAAGATCCACTGG - Intergenic
1033163945 7:139022468-139022490 CCCTGCAGCCTTGATTTCTCAGG - Intergenic
1034879861 7:154755305-154755327 CCCAGCAGCCCAGCATGCACAGG + Intronic
1035441966 7:158909654-158909676 CCCAGCGGCCTTGGTTGCTCCGG - Intronic
1035550540 8:520585-520607 CCCCGCATCCTTGGTTACACTGG + Intronic
1037301328 8:17454658-17454680 CCCCGCAGCCTTGGCCTCACCGG - Intergenic
1038936457 8:32257197-32257219 CCCAGCAGGCTAAGATCCACTGG - Intronic
1040333241 8:46403065-46403087 CCCAGGAGCCCCGTTTTCACTGG - Intergenic
1040837391 8:51746795-51746817 CACTGCAGCCTAGACTTCACTGG + Intronic
1044492778 8:92839963-92839985 CCTAGCAGCCTTGGTCTCCCTGG + Intergenic
1044785216 8:95786440-95786462 CCAAGCAGCCTCAGTTCCACTGG - Intergenic
1045185186 8:99830512-99830534 CCCAGCAGGCTAAGATCCACTGG - Intronic
1046047981 8:108986471-108986493 CCCAGCAAGCTAAGATTCACTGG - Intergenic
1047229088 8:122980692-122980714 ATCAGCAGCATAGGTATCACCGG + Intergenic
1048043361 8:130751371-130751393 CCCAGAGGCCTAGGTTTCATGGG - Intergenic
1049016083 8:139921125-139921147 TCCATCAGCCTGTGTTTCACAGG - Intronic
1049312141 8:141938876-141938898 CCCAGCAGCCTCTGACTCACAGG - Intergenic
1050031759 9:1393604-1393626 CCCAGCAGGCTAAGATCCACTGG + Intergenic
1051792517 9:20823067-20823089 TCCAGCAGCCTTGGTATTACAGG + Exonic
1052026262 9:23576773-23576795 CCCAGGTGTCAAGGTTTCACTGG + Intergenic
1052791036 9:32875901-32875923 CTCAGCACCCTGGGTGTCACGGG + Intergenic
1053031968 9:34788111-34788133 CACTGCAGCCTTGGTTTCCCAGG + Intergenic
1053347999 9:37392278-37392300 CCCAGTAGCTTAGGGGTCACTGG + Intergenic
1053459489 9:38257610-38257632 ACCAGCAGCATAGGCATCACTGG + Intergenic
1054976553 9:71153364-71153386 CCCAGGAGGCTAGGTTGCAGTGG - Intronic
1055571768 9:77623996-77624018 CCCAGCAAGCTACGTTCCACTGG + Intronic
1057306308 9:93914128-93914150 CCCAGCAGCTTCTGGTTCACTGG - Intergenic
1059735651 9:117097064-117097086 TCCTGCAGCCTAGGTACCACTGG - Intronic
1061376001 9:130225114-130225136 CACAGCAGACTTGGTTTCTCAGG - Intronic
1062035520 9:134380931-134380953 CCCAGCAGCTGAGGGTTCAGGGG + Intronic
1062200457 9:135300147-135300169 CCCAGCAGCCTGGGCATCAGAGG - Intergenic
1189317325 X:40065225-40065247 CCCAGCAGCCTGGGTCTGCCTGG - Intronic
1193136078 X:77972265-77972287 CACTGCAGCCTAGATTTCCCAGG + Intronic
1193719886 X:84974363-84974385 CCCAGCATCTTAAGTTTCATTGG + Intergenic
1194139856 X:90196187-90196209 CCCAGCAAGCTAAGATTCACTGG + Intergenic
1199436597 X:147819601-147819623 CCCAGCAAGCTAAGATTCACTGG + Intergenic
1200388501 X:155918220-155918242 CCCAGCAGGCTAAGATCCACTGG - Intronic
1200936098 Y:8739816-8739838 CCCTTCATCCTGGGTTTCACAGG + Intergenic
1201394767 Y:13536733-13536755 CCCAACAGCCTAAGATCCACTGG - Intergenic
1201720428 Y:17090335-17090357 CCCAGCAGACTGTGTTTGACTGG - Intergenic