ID: 1149482028

View in Genome Browser
Species Human (GRCh38)
Location 17:57011348-57011370
Sequence GTGGACTCTGATTCTCTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149482026_1149482028 -10 Left 1149482026 17:57011335-57011357 CCAAAGACAAAAAGTGGACTCTG No data
Right 1149482028 17:57011348-57011370 GTGGACTCTGATTCTCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149482028 Original CRISPR GTGGACTCTGATTCTCTTCT GGG Intergenic