ID: 1149483148

View in Genome Browser
Species Human (GRCh38)
Location 17:57019563-57019585
Sequence CACAGGGATGGAGCTACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149483148_1149483160 18 Left 1149483148 17:57019563-57019585 CCTTGGGTAGCTCCATCCCTGTG No data
Right 1149483160 17:57019604-57019626 CCCACAGCTGCTTTCACGGTAGG No data
1149483148_1149483156 14 Left 1149483148 17:57019563-57019585 CCTTGGGTAGCTCCATCCCTGTG No data
Right 1149483156 17:57019600-57019622 AGCCCCCACAGCTGCTTTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149483148 Original CRISPR CACAGGGATGGAGCTACCCA AGG (reversed) Intergenic
No off target data available for this crispr