ID: 1149485038

View in Genome Browser
Species Human (GRCh38)
Location 17:57036084-57036106
Sequence CAATTTGTCCAGAGGGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149485038_1149485042 -10 Left 1149485038 17:57036084-57036106 CCAAGTGCCCTCTGGACAAATTG No data
Right 1149485042 17:57036097-57036119 GGACAAATTGGCACAATGTGAGG No data
1149485038_1149485043 4 Left 1149485038 17:57036084-57036106 CCAAGTGCCCTCTGGACAAATTG No data
Right 1149485043 17:57036111-57036133 AATGTGAGGATTTTCCAATTTGG No data
1149485038_1149485045 28 Left 1149485038 17:57036084-57036106 CCAAGTGCCCTCTGGACAAATTG No data
Right 1149485045 17:57036135-57036157 AGAGAAAGAGCCTGTTCTCCAGG No data
1149485038_1149485046 29 Left 1149485038 17:57036084-57036106 CCAAGTGCCCTCTGGACAAATTG No data
Right 1149485046 17:57036136-57036158 GAGAAAGAGCCTGTTCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149485038 Original CRISPR CAATTTGTCCAGAGGGCACT TGG (reversed) Intergenic
No off target data available for this crispr