ID: 1149488832

View in Genome Browser
Species Human (GRCh38)
Location 17:57067260-57067282
Sequence AATAGCACATTTAGCACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149488832_1149488835 6 Left 1149488832 17:57067260-57067282 CCTTCAGTGCTAAATGTGCTATT No data
Right 1149488835 17:57067289-57067311 GACAGTCCTTCTAGCCAACTGGG No data
1149488832_1149488834 5 Left 1149488832 17:57067260-57067282 CCTTCAGTGCTAAATGTGCTATT No data
Right 1149488834 17:57067288-57067310 TGACAGTCCTTCTAGCCAACTGG No data
1149488832_1149488837 19 Left 1149488832 17:57067260-57067282 CCTTCAGTGCTAAATGTGCTATT No data
Right 1149488837 17:57067302-57067324 GCCAACTGGGTCTAGTATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149488832 Original CRISPR AATAGCACATTTAGCACTGA AGG (reversed) Intergenic
No off target data available for this crispr