ID: 1149488835

View in Genome Browser
Species Human (GRCh38)
Location 17:57067289-57067311
Sequence GACAGTCCTTCTAGCCAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149488832_1149488835 6 Left 1149488832 17:57067260-57067282 CCTTCAGTGCTAAATGTGCTATT No data
Right 1149488835 17:57067289-57067311 GACAGTCCTTCTAGCCAACTGGG No data
1149488831_1149488835 19 Left 1149488831 17:57067247-57067269 CCATGAGTCAGTACCTTCAGTGC No data
Right 1149488835 17:57067289-57067311 GACAGTCCTTCTAGCCAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149488835 Original CRISPR GACAGTCCTTCTAGCCAACT GGG Intergenic
No off target data available for this crispr