ID: 1149493535

View in Genome Browser
Species Human (GRCh38)
Location 17:57102069-57102091
Sequence CAGCCTGTGCAGAGGTACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149493528_1149493535 21 Left 1149493528 17:57102025-57102047 CCCTGAAATGTTTGTTAATCCCA 0: 1
1: 0
2: 1
3: 9
4: 249
Right 1149493535 17:57102069-57102091 CAGCCTGTGCAGAGGTACGTGGG 0: 1
1: 0
2: 1
3: 11
4: 173
1149493529_1149493535 20 Left 1149493529 17:57102026-57102048 CCTGAAATGTTTGTTAATCCCAA 0: 1
1: 0
2: 1
3: 20
4: 234
Right 1149493535 17:57102069-57102091 CAGCCTGTGCAGAGGTACGTGGG 0: 1
1: 0
2: 1
3: 11
4: 173
1149493527_1149493535 22 Left 1149493527 17:57102024-57102046 CCCCTGAAATGTTTGTTAATCCC 0: 1
1: 0
2: 0
3: 13
4: 185
Right 1149493535 17:57102069-57102091 CAGCCTGTGCAGAGGTACGTGGG 0: 1
1: 0
2: 1
3: 11
4: 173
1149493530_1149493535 2 Left 1149493530 17:57102044-57102066 CCCAATTTTGTTTCAAATGATGC 0: 1
1: 0
2: 4
3: 39
4: 325
Right 1149493535 17:57102069-57102091 CAGCCTGTGCAGAGGTACGTGGG 0: 1
1: 0
2: 1
3: 11
4: 173
1149493531_1149493535 1 Left 1149493531 17:57102045-57102067 CCAATTTTGTTTCAAATGATGCC 0: 1
1: 0
2: 1
3: 29
4: 249
Right 1149493535 17:57102069-57102091 CAGCCTGTGCAGAGGTACGTGGG 0: 1
1: 0
2: 1
3: 11
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149493535 Original CRISPR CAGCCTGTGCAGAGGTACGT GGG Intronic
900230660 1:1555409-1555431 CAGCCTGGGCAGTGGCACCTCGG + Intronic
901012583 1:6209957-6209979 CAGGCTGTGCAGAGGTGAGTTGG + Exonic
901234138 1:7658510-7658532 CTGCCTGTGCAGCGGTACAGAGG + Intronic
902651783 1:17842128-17842150 CAGCGTGTGCAAAGGTACTGAGG - Intergenic
903682300 1:25105078-25105100 CAGCATGTGCAAAGGTCTGTGGG - Intergenic
904003908 1:27353475-27353497 CAGCCTGGGCACCGGTAAGTGGG + Exonic
904770183 1:32876788-32876810 CAGGCTGTGCAGAGCCACGAGGG - Intergenic
905594727 1:39196781-39196803 AAGCCTGTGCAAAGGTATGCTGG - Intronic
906415867 1:45621272-45621294 CAGCCTGTGCCCAGGTCAGTAGG - Exonic
907300490 1:53483791-53483813 CAGCCTCTGCAGAGGTGGGAGGG + Intergenic
910723617 1:90314665-90314687 CAGGCTGTGCAGAGGAACATGGG + Intergenic
911130447 1:94382301-94382323 CAGGCTGTGGGGAGGTACTTGGG + Intergenic
918968205 1:191378433-191378455 CAGGCTGTGCAGAGCTGCGGTGG + Intergenic
921931932 1:220761960-220761982 CAGCCTAGGCAGAGGTACCAGGG + Intronic
921955997 1:220983767-220983789 GAGCCTGTGCACAGGGACCTAGG + Intergenic
924418303 1:243882800-243882822 CAGCCTATGCTGAGGTCCGAGGG - Intergenic
924886039 1:248217887-248217909 CAGCCTGTGCAGAAGTCAGATGG - Intergenic
1062857613 10:787125-787147 CAGCCTTTTCAGAGGTAGTTAGG + Intergenic
1069886261 10:71625688-71625710 CAACCTTTGCAGAGCTGCGTGGG - Intronic
1073078159 10:100837448-100837470 CAGCCTGTGCAAAGGTCAGAAGG - Intergenic
1074720804 10:116263533-116263555 CAGCAGGTGCAAAGGTACGGAGG + Intronic
1075885043 10:125892575-125892597 CAGCCTGGGCTGAGGCACGAAGG - Intronic
1076071607 10:127494468-127494490 GACCCTGTGCAAAGGCACGTCGG + Intergenic
1078610733 11:12816926-12816948 CAGCATGTGCAGAGGCCCGCTGG + Intronic
1079009167 11:16814401-16814423 CAGGCTGTACAGAGGTAGGCAGG - Intronic
1080332897 11:31161108-31161130 CAGCCTGTGAAGCTGTAAGTTGG + Intronic
1083743900 11:64724718-64724740 CAGCCTGTGAAGGGGTAAGAGGG + Intergenic
1089133751 11:116232998-116233020 CAGCATGTGCAAAGGTATGGAGG - Intergenic
1089620566 11:119719973-119719995 CAGCATGTGCAAAGGCACGGAGG + Intronic
1090816087 11:130297419-130297441 CTGCTTGTGCAGAGGTAAGTTGG - Intronic
1091330311 11:134726737-134726759 CAGCCAGTGCAGAAGCACCTGGG + Intergenic
1093655277 12:21687602-21687624 CAGCCTGTGCAGAGCCAAGGGGG + Intronic
1094479527 12:30870603-30870625 CAGCCTGTGGAGATGAACCTAGG - Intergenic
1095530192 12:43177997-43178019 CAGCCTGTGCAGAGGTCACATGG - Intergenic
1096495802 12:52038496-52038518 CAGGCTGGGCAGAGGTTGGTAGG + Intronic
1096562616 12:52447570-52447592 CAGCCTGTGGAGAGGAACACAGG + Exonic
1096564787 12:52469442-52469464 CAGCCTGTGGAGAGGAACACAGG + Exonic
1096566705 12:52488100-52488122 CAGCCTGTGGAGAGGAACACAGG + Exonic
1097046678 12:56191851-56191873 CAGCCTGAGCAGTGGTATGAAGG - Intergenic
1097282196 12:57852009-57852031 CTGCCTGTGCAAAGGTAGGGAGG - Intergenic
1100107486 12:91193668-91193690 CAGGCTATGCAGAGGGAAGTGGG - Intergenic
1100307211 12:93361815-93361837 CAGCCTGTGCTGAGATCTGTGGG - Intergenic
1103003916 12:117406814-117406836 CAGCATGTGCAAAGGTACAGAGG - Intronic
1103935862 12:124476165-124476187 CAGCCTGTGCAAAGGCCCGGGGG - Intronic
1104730983 12:131105178-131105200 ACGCCTGTGCTGAGGAACGTGGG - Intronic
1104897386 12:132171081-132171103 CAGGCTGTGCAGTGCTGCGTGGG + Intergenic
1105805835 13:23951146-23951168 CACCCTCTCCAGAGGTACCTGGG + Intergenic
1106454267 13:29912951-29912973 CAGCAGGTGCAAAGGTACGGAGG + Intergenic
1117555218 14:56876936-56876958 CAGCATGTGCAAAGGTAGGAAGG + Intergenic
1118314891 14:64720032-64720054 CAGCCAGTGTAGAGGTAACTTGG - Intronic
1119255254 14:73190064-73190086 CAGGCTGTGCAGAGGAAGGCAGG + Intronic
1122782217 14:104148577-104148599 CAGCCTGTGCAGAGGTTGGAAGG + Intronic
1202872997 14_GL000225v1_random:181379-181401 CAGCCTGGGCTGAGGCACGAAGG + Intergenic
1124169793 15:27362435-27362457 CAGCCTGTGAAGATGTTCTTTGG + Intronic
1130143655 15:81254753-81254775 CACACTGTGCAGACGTTCGTGGG + Intronic
1130821635 15:87502227-87502249 CAGCCTGTGCAAAGGCATGGGGG - Intergenic
1131023652 15:89121418-89121440 CAGCCTGTCCAGGAGTACGGGGG - Intronic
1131069725 15:89458591-89458613 CAGCCTGTGCAAAGGTCCTGAGG + Intergenic
1131153081 15:90059216-90059238 CAGCCTGTGCAGAGGCCCCAAGG + Intronic
1132064903 15:98722785-98722807 CTGCCTTTGCAGAGGTCTGTGGG + Intronic
1133319567 16:4904591-4904613 CAGCCTGTGCAAAGGTCCTGAGG + Intronic
1133559015 16:6932597-6932619 CAGCCTGTGGACAGGCCCGTGGG - Intronic
1134118432 16:11566741-11566763 CAGCCTGGGCAGGGGTAGGGGGG + Intronic
1134830969 16:17322574-17322596 CAGCATGTGCAGAGGTCCTGAGG - Intronic
1142995445 17:3757346-3757368 CAGCATGTGCAGAGGTGAGGAGG - Intronic
1143374680 17:6460234-6460256 CAGCATGTGCAAAGGCACGGAGG - Intronic
1146541704 17:33701678-33701700 CAGCCTTTGCAGTGCTACCTTGG + Intronic
1148844460 17:50521075-50521097 CAGCCTGTGCTGAGGGTCCTTGG + Intronic
1149131032 17:53302795-53302817 CAGCCTGTGCAGAGCCCAGTTGG + Intergenic
1149493535 17:57102069-57102091 CAGCCTGTGCAGAGGTACGTGGG + Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1151676472 17:75601393-75601415 CAGCCTGTGCAGAGGCGTGAAGG + Intergenic
1151698270 17:75729246-75729268 CAGCCTGGGCAGAGGTGGGAGGG - Exonic
1151885979 17:76923623-76923645 CAGCGTGTGCTGAGGCACGGTGG - Intronic
1152286311 17:79415170-79415192 CCGCCTTTGCCGAGGTACCTGGG + Intronic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1153313952 18:3703910-3703932 CTGCCTGTGAAGGGGAACGTGGG - Intronic
1155334068 18:24747142-24747164 CAGCCTGTGCAGAGGTTCTGAGG - Intergenic
1157200062 18:45652431-45652453 CAGCCTGTGCAGCGGTAGAAGGG - Intronic
1158367032 18:56747724-56747746 CAGCCTGTGCAGATGCAGGTGGG + Intronic
1159636427 18:70810178-70810200 CAGCTGGGGCAGAGGCACGTGGG + Intergenic
1160521178 18:79509120-79509142 CAGCCTCCGCAGAGGTGTGTGGG + Intronic
1162490519 19:10988585-10988607 CAGCCTGTGCAAAGGTCCTGGGG - Intronic
1165723052 19:38093288-38093310 CAGCCAGTGCAGAGGTCCTGAGG + Intronic
1166313843 19:41977843-41977865 CAGGCAGTGCAGAGGGAGGTTGG + Intronic
925280926 2:2683835-2683857 CAGCCTGCACAGTGGTAAGTGGG - Intergenic
929005925 2:37392651-37392673 CAGCCTGTGCAAAGGTCCTGAGG - Intergenic
933728408 2:85438941-85438963 CAGCCTGGGCCCAGGTACTTAGG + Intergenic
934892693 2:98084673-98084695 CAGCCTTGGGAGAGGTAGGTGGG - Intergenic
936062022 2:109301188-109301210 CAGCCTGCGCAGAGGAACCAGGG - Intronic
936174207 2:110204870-110204892 CAGGCTGTGCAGAGGGCCCTGGG - Intronic
936523319 2:113226139-113226161 CACCCTATGCAGAGGCAGGTGGG - Intronic
938454923 2:131454658-131454680 GAGGCTGTGCAGAGGCACTTTGG + Intergenic
938579782 2:132635598-132635620 CAGCGTGTGCAGAGGCATGGAGG + Intronic
938902048 2:135806858-135806880 GAGCCTGGGCAGAAGTACTTGGG - Intronic
943066194 2:183089299-183089321 CTGCCTGTCCAGAGGTATTTTGG - Intronic
948023664 2:234758306-234758328 CAGCCAGTGCAAAGGTACTGAGG - Intergenic
948125704 2:235563425-235563447 CTGCCTGGGCAGAGGAAAGTGGG - Intronic
948810386 2:240472288-240472310 CAGCCTGTGCAGTTGTAGATTGG - Intergenic
1169112496 20:3043174-3043196 CAGGCTGTTCAGAGGTACAGGGG - Intergenic
1169215815 20:3794431-3794453 CACCCTGTGCAGATGTATATTGG + Intronic
1170829859 20:19830774-19830796 CAGCCCCTGCAGGGGTACCTTGG + Intergenic
1172776364 20:37409512-37409534 CAGCCTGTGCACAGGCAGGTGGG - Intergenic
1172962771 20:38810188-38810210 CAGCATGTGCAGAGGCACCGAGG + Intronic
1173585029 20:44175894-44175916 AGGCCTGTGCACAGGTAGGTGGG - Intronic
1173691861 20:44966830-44966852 GAGACTGTGCTGAGGAACGTGGG + Intronic
1173849297 20:46207757-46207779 CAGCTTGTGCAGAGGTATACAGG - Intronic
1174528580 20:51193032-51193054 CAGCCAGTGCAGAGGTCCTGAGG - Intergenic
1176870065 21:14076755-14076777 CAGCCTATGCAGAGACACGTTGG - Intergenic
1180285100 22:10738137-10738159 CAGCCTGGGCTGAGGCACGAAGG - Intergenic
1181440069 22:22931168-22931190 CAGCCTGTGCAGGGACATGTTGG + Intergenic
1182249533 22:28989168-28989190 CAGCCTCTCCAGAGAAACGTGGG - Intronic
1183789607 22:40055378-40055400 CAGCCTGTGTAGAGGCATGGGGG + Intronic
1184278664 22:43425196-43425218 CCGCATGTGCAGATGTAAGTGGG + Exonic
1185358156 22:50387575-50387597 CAGCCTATCCAGTGGTATGTTGG + Intronic
949951896 3:9236149-9236171 CAGCATGTGCAAAGGTATGGGGG - Intronic
950643803 3:14365195-14365217 CAGCTTGTGCAGAGGTTCAGAGG - Intergenic
950676896 3:14559636-14559658 CAGCCTGTTCAGAGCTAATTTGG + Intergenic
951680059 3:25285409-25285431 CAGGCTGTGCAGGGGTTTGTAGG + Intronic
952391729 3:32886268-32886290 AAGCCTTTTCAGAAGTACGTGGG + Intronic
953137696 3:40197314-40197336 CAGCCTGTGCAGCAGGAGGTGGG - Intronic
954414023 3:50384195-50384217 CAGCCTTTGTAGATGTCCGTAGG + Exonic
961021577 3:123511956-123511978 CAGCCTGTGCAGAGGTCACATGG - Intronic
961372630 3:126440806-126440828 CAGCCTGGGCAGAGGTGGGCTGG - Intronic
961468780 3:127098265-127098287 CAGCATTTGCAGAGGTACTGTGG - Intergenic
962001792 3:131305606-131305628 CAGCCTGTGCAGAGCCAAGAGGG - Intronic
963818043 3:149855737-149855759 CAGCCTTTGCAAAGGTAATTTGG - Intronic
966236919 3:177712065-177712087 CAGCTTGTGAAGAGTTAAGTAGG - Intergenic
966959435 3:184919102-184919124 CAGCATGAGCAAAGGTACTTTGG + Intronic
969480485 4:7444488-7444510 CAGCCTGTGCAAAGGTCCTGTGG + Intronic
969570579 4:8005967-8005989 CTGCCTGTGCAGATGCACGCAGG - Intronic
969605070 4:8198347-8198369 CAGCCTGTGCTGTGATAGGTCGG - Intronic
971036909 4:22703709-22703731 CAGCATGTGCAAAGGTACAGAGG - Intergenic
983024196 4:162713475-162713497 CAGACTGTGTAGAGGTGGGTAGG - Intergenic
983302532 4:165945796-165945818 CAGCCTGTGGACAGGTATCTTGG - Intronic
985969267 5:3362304-3362326 CAGCCTGTGCAGTGGTTTGAGGG + Intergenic
993580974 5:89660817-89660839 CAGCCTGAGCAGTAGTACTTGGG - Intergenic
997234521 5:132265114-132265136 TAGGCTGTGCAAAGGTACCTTGG - Intronic
999380762 5:151119432-151119454 CCTCCTGTGCAGAGGTCCATGGG + Intronic
1001946491 5:175782825-175782847 CAGCCTGTGGAGAGGTCCACAGG + Intergenic
1002571326 5:180140835-180140857 CAGCATGTGCAGAGGCTCGGCGG + Intronic
1002715439 5:181223964-181223986 CAGCCAGTGTAGAGGTTCGGTGG - Exonic
1003217359 6:4126609-4126631 CAGCCTGTGCAAAGGCTCTTTGG + Intronic
1006444218 6:34069816-34069838 CAGCATGTGCAGAGGCCTGTTGG - Intronic
1007520241 6:42446357-42446379 GAGCCTGTGCAGAAGGACTTTGG - Intronic
1007550410 6:42725522-42725544 CAGCCTGTGCATAAGTACAAGGG + Intergenic
1011560324 6:88607508-88607530 CAGCCTGTGCAAAGATTCCTGGG + Intergenic
1013348709 6:109287232-109287254 CAGCCTTTGCAGAATTAAGTAGG - Intergenic
1014441646 6:121480372-121480394 CAGCGTGTGAAAAGGTAAGTTGG - Intergenic
1017880376 6:158558882-158558904 CAGACTGTTCACAGGGACGTGGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1019650455 7:2154907-2154929 CAGCCTGTGGAGAAGGACGGAGG + Intronic
1019875856 7:3809934-3809956 CAGCCTCTGCAGAGAAGCGTTGG - Intronic
1021625603 7:22590042-22590064 CAGCCTTTCCAGAGGAATGTGGG + Intronic
1022571235 7:31456104-31456126 TAGCCTGTGCAGAGATACGGAGG - Intergenic
1022652143 7:32287331-32287353 CAGCCTGTGCAGAGGCCCTGTGG - Intronic
1027149332 7:75721636-75721658 CAGCCTGTGCAACTGTACCTGGG + Intronic
1027263275 7:76479897-76479919 GGGCCTGTGCGGCGGTACGTAGG + Intronic
1027314655 7:76978002-76978024 GGGCCTGTGCGGTGGTACGTAGG + Intergenic
1027355369 7:77349057-77349079 CAGCCTGTTCTGAGGTACAGTGG + Intronic
1027948484 7:84780968-84780990 CAGCCTGTGCAGAGCTCAGAGGG - Intergenic
1028618023 7:92791792-92791814 CAGCATGTCCAAAGGTATGTAGG + Intronic
1029652977 7:101906420-101906442 CAGCCTGTGGCGAGGTCCGAGGG + Intronic
1033398948 7:141003374-141003396 CAGCCTGTACAGAAGTACGATGG - Intergenic
1034430043 7:151036636-151036658 CAGACAGTGCAAAGGTAAGTGGG + Exonic
1039969495 8:42309012-42309034 CAGCCCGTGCAGTGGTGAGTGGG + Exonic
1040903336 8:52439568-52439590 AGGCCTGAGCAGAGGCACGTGGG + Intronic
1045775506 8:105797742-105797764 CAGCCTGAGCTGAGGTATGAAGG - Intronic
1046805956 8:118479235-118479257 CAGCCAGTGCAGAGGTCCTGAGG - Intronic
1049756494 8:144313383-144313405 CAGCCTGTGCAGGCGTACACGGG + Intronic
1050842862 9:10174369-10174391 CAGCCTGTGCAGAGGTCACTTGG - Intronic
1051705743 9:19878051-19878073 CACCCTGTGCAGAGGCATTTTGG + Intergenic
1054736955 9:68763209-68763231 CAGCCTGTGCAGAGGAAAAGAGG + Intronic
1055609591 9:78008170-78008192 CCACCTGTGTAGAGGTACATGGG - Intronic
1060051719 9:120382968-120382990 CAGCCTGTGCAAAGGCATGGAGG - Intergenic
1061984396 9:134121531-134121553 CAGCCTGTGCAGAGATCCCATGG + Intergenic
1062607827 9:137355921-137355943 CAGCCTGTCCAGAGGGGCCTGGG + Intronic
1203731459 Un_GL000216v2:95166-95188 CAGCCTGGGCTGAGGCACGAAGG - Intergenic
1190753482 X:53381445-53381467 CAGCATGTGCAGAGGCAAGGAGG - Intronic
1190912683 X:54787248-54787270 CAGCATGTGCAGAGGCACAGAGG - Intronic
1190978725 X:55434578-55434600 CAGTTTGTGGAGAGGTACCTGGG + Intergenic
1195379257 X:104255354-104255376 CAGCCCGTGGAGAGGTATTTTGG + Intergenic
1196487187 X:116225776-116225798 CTGCTTGTGGAGAGGTACATTGG + Intergenic
1196685650 X:118508228-118508250 CTGGCTCTGCAGAGGTACCTGGG + Intronic
1198186594 X:134259420-134259442 CAGCCTGTGCTGAGTGAAGTTGG - Intergenic
1198579580 X:138048935-138048957 CAGCCTGTGCAGAGCTCAGAGGG + Intergenic