ID: 1149495494

View in Genome Browser
Species Human (GRCh38)
Location 17:57114758-57114780
Sequence CCATTGTTATGGAGCTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149495487_1149495494 8 Left 1149495487 17:57114727-57114749 CCTTCATGGAAGCAGCATCCTTC 0: 1
1: 0
2: 0
3: 23
4: 219
Right 1149495494 17:57114758-57114780 CCATTGTTATGGAGCTGGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 156
1149495488_1149495494 -10 Left 1149495488 17:57114745-57114767 CCTTCAATTCTTGCCATTGTTAT 0: 1
1: 0
2: 0
3: 21
4: 289
Right 1149495494 17:57114758-57114780 CCATTGTTATGGAGCTGGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149495494 Original CRISPR CCATTGTTATGGAGCTGGGG TGG Intronic
900884636 1:5405652-5405674 TCTTTCTTATGGAGCTGGGACGG + Intergenic
901754916 1:11435574-11435596 CCCTAGTTCTGGAGCTGGGTGGG - Intergenic
903056897 1:20642207-20642229 CCATTGTTATGCAGCAAAGGGGG + Intronic
903987753 1:27241242-27241264 CCATTTTCTTGGAGATGGGGTGG + Intronic
904929682 1:34076811-34076833 CCAATGCTATGCAGCTAGGGAGG + Intronic
905533100 1:38697642-38697664 CCACTGTTATTGAGCTAGAGAGG + Intergenic
911137855 1:94461281-94461303 CCTTTGTGATGGAGATAGGGTGG + Intronic
914226551 1:145724029-145724051 ACATTGTTACGGAGCTTTGGGGG - Intronic
915304404 1:154969489-154969511 CCTTTGTGAAGGGGCTGGGGTGG - Intronic
918235413 1:182575421-182575443 TCAGTGTGATGGAGCTGGTGGGG - Exonic
919521899 1:198599525-198599547 CTATTGTTCTGGAGGTGGAGTGG + Intergenic
920202259 1:204266761-204266783 CAATTGTTATGAAGCAGGAGAGG - Intronic
921540421 1:216407138-216407160 CAATTGTTATCAACCTGGGGTGG - Intronic
1063920574 10:10928187-10928209 ACATTGTTCTGGAGCTAAGGGGG - Intergenic
1066362769 10:34747254-34747276 CGATTCTAAGGGAGCTGGGGCGG + Intronic
1067274540 10:44822036-44822058 CCCTTCTTCTGGAGCTTGGGTGG - Intergenic
1068314284 10:55320895-55320917 CCATTGGTATGGAACTAGTGTGG - Intronic
1070775863 10:79109513-79109535 CCATCCATATGGAGGTGGGGTGG - Intronic
1073670871 10:105586544-105586566 CCAATTTTATGGACCTGGGCAGG - Intergenic
1078651294 11:13196399-13196421 CCATTTTTTTGGAGGTGTGGTGG - Intergenic
1079331972 11:19541210-19541232 CCATTGCTCTGGATTTGGGGTGG + Intronic
1079351181 11:19693303-19693325 CCATTGTCATGAGGTTGGGGCGG + Intronic
1081992318 11:47344460-47344482 GCATTGTTGTGGAGCAGGGCTGG - Intronic
1084934918 11:72581744-72581766 CCAGTCTTATGGGGGTGGGGAGG - Intronic
1087233655 11:95694801-95694823 TCATTTTTATGGAGCTGGCTAGG - Intergenic
1088593475 11:111422734-111422756 CCATTCTTATTGAGCAGGGGAGG - Intronic
1088789863 11:113214794-113214816 CCAGAGTTATGGAGCTGTGAGGG + Intronic
1090415824 11:126539759-126539781 CAATGGTTCTGGAGCTGGGAAGG + Intronic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1092968064 12:13664300-13664322 CCATGATTTTGGGGCTGGGGTGG + Intronic
1095570358 12:43676796-43676818 CCATTGCTAGAGAGCTGGTGTGG - Intergenic
1098134146 12:67383800-67383822 CCAGGGTCATGGAGCTGGTGGGG + Intergenic
1099317859 12:81106978-81107000 CAGTTGTGATGGAGCTGTGGGGG + Intronic
1101965341 12:109278697-109278719 CCATTGTTTGGGGGCTTGGGGGG - Exonic
1102703919 12:114864699-114864721 CCATTGTCATGGAGGAGGGAAGG + Intergenic
1105929707 13:25041141-25041163 GCAGTGATATGGAGCTGGAGGGG - Intergenic
1109322102 13:60823528-60823550 CCATTGTGATGGAGGGGGTGGGG + Intergenic
1110517279 13:76429163-76429185 CAACTGTTGTGGAACTGGGGAGG + Intergenic
1117973119 14:61271839-61271861 CCAGTGTTATGCAGCTGGTTGGG - Intronic
1118603769 14:67488450-67488472 CGTTTGTGAAGGAGCTGGGGAGG - Intronic
1118793928 14:69122459-69122481 CGAATCTTATGGAGTTGGGGAGG - Intronic
1120455169 14:84720253-84720275 CCATTGCTAGAGAGCTGGTGTGG - Intergenic
1122045986 14:99024078-99024100 CCACTGTCATGGAGTTGAGGTGG - Intergenic
1126227536 15:46289170-46289192 CCATTGCTATGGAACTAGTGCGG + Intergenic
1130225186 15:82051854-82051876 CCGTTGATATGGAGCCGGGCAGG + Intergenic
1131026030 15:89142396-89142418 CCTTTGTTAAAGAGCTTGGGGGG + Intronic
1131281798 15:91027420-91027442 CTATTTTTATAGAGATGGGGGGG + Intergenic
1133629128 16:7602368-7602390 GCCTTGTTGTGGGGCTGGGGGGG + Intronic
1136878746 16:33885412-33885434 CCTTTGTTGGGGAGGTGGGGGGG + Intergenic
1139432501 16:66918637-66918659 CCCTTGTCATGGAGCTGGGCAGG + Intronic
1140034944 16:71364683-71364705 CCGTGGTTCTGGAGCTGGGCTGG - Intronic
1141410520 16:83829871-83829893 CCATGGTGATGGAGCTGCAGGGG + Intergenic
1142788588 17:2245044-2245066 CCATGATTATGGAGCCGGAGTGG - Intronic
1143268516 17:5658576-5658598 CCATGGGTTTGGGGCTGGGGAGG + Intergenic
1147998845 17:44375972-44375994 CCATTGTTGTGGAGCTGAAGGGG + Exonic
1148190445 17:45675020-45675042 ACTGTGTTAAGGAGCTGGGGAGG - Intergenic
1149495494 17:57114758-57114780 CCATTGTTATGGAGCTGGGGTGG + Intronic
1151462458 17:74262637-74262659 CCATTGTCTCGGAGCTGGAGTGG + Intergenic
1155421981 18:25665732-25665754 CCATGGTCATGGACCTGGAGCGG - Intergenic
1156206405 18:34890593-34890615 CCATTAATATGGCGCTGTGGAGG - Exonic
1156708526 18:39913225-39913247 TCATAGTTCTGGAGCTTGGGAGG - Intergenic
1156712676 18:39965854-39965876 CCATTCTAATGGTGCTGGGGAGG + Intergenic
1157142480 18:45123617-45123639 CAAGTGCTATGGAGCTGGGAAGG + Intergenic
1157800736 18:50618782-50618804 CCATTATTATGGAGTGGGGCAGG + Intronic
1161296570 19:3523287-3523309 CCAGAGTGGTGGAGCTGGGGCGG + Intronic
1163162820 19:15475745-15475767 CCAGTACTATGGGGCTGGGGTGG - Exonic
1163432012 19:17273895-17273917 CGTTGGTTTTGGAGCTGGGGAGG - Exonic
1163968010 19:20765864-20765886 CCATTGCTAGGGAGCTAGTGTGG - Intronic
1164302111 19:23971907-23971929 CGTTTGTTAAGGAGCAGGGGAGG - Intergenic
1165294241 19:34913382-34913404 GCATTGTTCTGTAGCTGGGCAGG + Intergenic
1165918348 19:39275611-39275633 CCAGTGTGATGGAGCTGCGAGGG + Intergenic
925829688 2:7882215-7882237 CCATTGTGTTGGAGATGGGAAGG + Intergenic
926274588 2:11393954-11393976 CCGTGGTCAGGGAGCTGGGGTGG - Intergenic
926492820 2:13545382-13545404 CCATGGTTATGTAGCTGGAGTGG + Intergenic
937169350 2:119850209-119850231 CCACTGCCCTGGAGCTGGGGTGG + Intronic
938577584 2:132619040-132619062 CCAGAGTTATGGAGCAGAGGTGG - Intronic
939672846 2:145034848-145034870 CCATTGGTATGGAGTTTTGGTGG - Intergenic
941839588 2:170066513-170066535 CAAGTTTTATGGAGGTGGGGGGG - Intronic
942070521 2:172311825-172311847 CCATTGTTCTGTCGCTGGGGAGG + Intergenic
945250693 2:207764229-207764251 CCAGCTTTGTGGAGCTGGGGAGG - Exonic
945718507 2:213387957-213387979 CCATTGTTATCTAGATGAGGAGG - Intronic
947437841 2:230088222-230088244 CCATTGTTATGGATGGAGGGTGG - Intergenic
947824998 2:233099766-233099788 CCACAGTGATGTAGCTGGGGTGG + Intronic
1170884806 20:20330784-20330806 CCATTTTTTTAGAGCTGGGAGGG - Intronic
1174040517 20:47696403-47696425 CCAAGGTTATGGGGGTGGGGGGG - Intronic
1174187762 20:48719307-48719329 CCCTTGTTGGGGAGTTGGGGGGG - Intronic
1177557886 21:22715360-22715382 GCATTAGTATGGCGCTGGGGGGG + Intergenic
1179608690 21:42534782-42534804 TCATTGTCAGGGAGCTGGTGGGG - Exonic
1179896233 21:44365261-44365283 CCACTGTCCTGGAGGTGGGGAGG + Intronic
1181483964 22:23218995-23219017 CCCTCGTTATGGAGCTGAGAAGG + Intronic
1182365118 22:29773426-29773448 CAGTTGTTTTGTAGCTGGGGTGG + Intergenic
1183669382 22:39263465-39263487 CCATGGTGAGGGAGCTGGGCGGG + Intergenic
1183990008 22:41591488-41591510 CCATAGTGGTGGAGCTGGGAAGG - Intergenic
1184233750 22:43172116-43172138 CCATTTTTATGGACCTGCAGAGG - Intronic
949601329 3:5601093-5601115 CCATTGTTCAGGAGCTAGTGTGG - Intergenic
950573009 3:13813640-13813662 CCTTTGCTATGTAGCTGGGCAGG + Intergenic
954578589 3:51690822-51690844 CCATTGTTTTACAGATGGGGAGG + Intronic
955045954 3:55359897-55359919 TCATTCTTATGGGACTGGGGTGG + Intergenic
955478896 3:59369116-59369138 CTATCTTTATGGAGCAGGGGAGG - Intergenic
958463907 3:94434328-94434350 CCAATGTCATGGAGGTGGGAAGG - Intergenic
959135012 3:102407249-102407271 CTATTGTTTTGCAGCTGGGTAGG + Intronic
962797615 3:138862754-138862776 CCATTGTTATGCAGGCGGAGGGG - Intergenic
966545481 3:181142099-181142121 CCATGCTGATAGAGCTGGGGAGG - Intergenic
966821583 3:183929003-183929025 CAAGTTTTATGGAGCTGAGGAGG - Intronic
967097418 3:186188361-186188383 CCAGTGTGATGGGGTTGGGGTGG - Exonic
967446176 3:189569173-189569195 CCATTGTTTTGACTCTGGGGAGG + Intergenic
969840639 4:9879148-9879170 CCATTGTAATGGGGTGGGGGTGG + Intronic
972142874 4:35983022-35983044 CCATTGCTGGGGAGCTGGTGTGG - Intronic
973569917 4:52227693-52227715 GCATTGTTATTGGGCTGGTGAGG + Intergenic
973831457 4:54764185-54764207 CCATTGTTGTTGAGCTAGTGTGG + Intergenic
975614042 4:76229371-76229393 CCATTGCTAGGGAGCTAGTGTGG + Intronic
976840036 4:89421608-89421630 CCATTGTCATGCAGCTGGCCTGG - Intergenic
978396456 4:108285688-108285710 CCAGTGGAGTGGAGCTGGGGAGG - Intergenic
978647873 4:110962046-110962068 GCATTGTTATGGGGTGGGGGTGG + Intergenic
979371629 4:119895240-119895262 CCATTGTTATAGACCAGGAGTGG + Intergenic
982172868 4:152678695-152678717 CCAGTGTTTTGGAGCTGGAAGGG - Intronic
982619495 4:157685967-157685989 CTATTGTTTTGGGGCTGGGGTGG + Intergenic
983011155 4:162549415-162549437 CCAATGCCATGGAACTGGGGTGG - Intergenic
984412577 4:179413546-179413568 CCACAGTCATGGAGCTGGGAGGG + Intergenic
990879105 5:60520275-60520297 CCACTGTGATGGAAATGGGGTGG - Intronic
993429561 5:87814737-87814759 CCATTGTTGCAGAGCTGGTGTGG - Intergenic
993588072 5:89757298-89757320 ACAATGTTCTGGAGTTGGGGTGG + Intergenic
999099437 5:149010937-149010959 CTATTGGCATGAAGCTGGGGAGG - Intronic
999565362 5:152854234-152854256 CTATTGTTATGTAGTTGTGGGGG - Intergenic
999743006 5:154571074-154571096 TTATTGTTTTGGAGCAGGGGAGG + Intergenic
999948671 5:156625136-156625158 TCATTCCTATGGTGCTGGGGAGG - Intronic
1005164114 6:22899454-22899476 ACATTTTTATAGAGATGGGGTGG + Intergenic
1007438709 6:41838733-41838755 CCATTGTTGGGGAGCTAGTGTGG - Intronic
1008845228 6:55955112-55955134 ACACTGTGATGAAGCTGGGGTGG + Intergenic
1010249813 6:73696012-73696034 CCATTGTAATGGGGATGGGAGGG + Intronic
1010372463 6:75126886-75126908 ACATTATTAGGTAGCTGGGGTGG - Intronic
1011717237 6:90120163-90120185 CCATTTTTAGGGTGCTGGTGAGG - Intronic
1011858954 6:91731238-91731260 ACATTGTTGTGAAGCTGGTGAGG + Intergenic
1016425521 6:143932686-143932708 CCATTGCTGGGGAGCTGGTGTGG + Intronic
1024100199 7:46024583-46024605 CCAGGGTTATGGATCTGGGGAGG + Intergenic
1024441282 7:49421384-49421406 CCATTGTTTTGGAACTTGAGTGG + Intergenic
1024698569 7:51882484-51882506 CCATTGTGATGGCCCTGGTGAGG - Intergenic
1024773416 7:52753837-52753859 CCATTGTTTTGGACTTAGGGTGG - Intergenic
1027668368 7:81067576-81067598 CCTTTGTTTTGGAGTGGGGGGGG - Intergenic
1027741138 7:82007251-82007273 CTATTGTTTGGGAGTTGGGGAGG + Intronic
1028536168 7:91890304-91890326 CCATTATTTTGGAGGTGGGGTGG + Intergenic
1029734145 7:102456182-102456204 CCTTTGTGATGGGGCTGTGGTGG - Exonic
1030371099 7:108700095-108700117 CCATTGTGATGGGGCCTGGGGGG + Intergenic
1031861027 7:126980679-126980701 CCAAGGTTAAGGAGCTGAGGAGG - Intronic
1033595575 7:142855840-142855862 CTGTGGTCATGGAGCTGGGGGGG - Intronic
1036557128 8:9870049-9870071 CCAGGGTTAGGGAGGTGGGGAGG + Intergenic
1036692312 8:10951752-10951774 CCACTGACATGCAGCTGGGGTGG - Intronic
1038424239 8:27454203-27454225 TCAATGTCATGGAGCTGGTGCGG + Exonic
1039216350 8:35275968-35275990 CCATTGTTTGGAAGATGGGGTGG + Intronic
1039616562 8:38959211-38959233 CCAGTCTTAGGGAGTTGGGGAGG + Intronic
1039765842 8:40626789-40626811 CAGTTATGATGGAGCTGGGGAGG + Intronic
1042808386 8:72797050-72797072 CCATCGTTATTGACCTGGAGAGG - Intronic
1042868486 8:73376917-73376939 CCATTGCTCTATAGCTGGGGAGG + Intergenic
1048273322 8:133046566-133046588 CCATTGTGCTGGGGCTGGGTGGG - Intronic
1048350527 8:133612258-133612280 CGACTACTATGGAGCTGGGGAGG - Intergenic
1048820133 8:138372853-138372875 CCATTGTTGGGCAGCTGGGATGG - Intronic
1049543065 8:143217304-143217326 CCAGGGTCATGGAGCTGGGGAGG - Intergenic
1051269746 9:15343958-15343980 CCATTCTTGGGAAGCTGGGGTGG - Intergenic
1051602706 9:18890728-18890750 CAATTTTTCAGGAGCTGGGGTGG - Intronic
1058198569 9:102009428-102009450 CCATTGCTAAGGAACTGGTGTGG - Intergenic
1060051970 9:120384220-120384242 CCATTGTGATCCAGCTGGAGGGG + Intergenic
1060713129 9:125890238-125890260 CCATTGTTTTGAAGCTGGTTGGG - Intronic
1061734576 9:132645219-132645241 CGTTTGTTATGGAGTCGGGGTGG - Intronic
1062505801 9:136875519-136875541 TCATTGTGGTGGAGCCGGGGAGG - Intronic
1191567346 X:62556557-62556579 CCTTTGTTCTGAAGCTGGTGAGG - Intergenic
1192689318 X:73345014-73345036 CAATTGTCATGGGGCTGAGGAGG + Intergenic
1192866041 X:75132947-75132969 CCATTGCTAGGGAGCTAGTGTGG - Intronic
1193668568 X:84355036-84355058 ACATTGATTTAGAGCTGGGGGGG - Intronic