ID: 1149500470

View in Genome Browser
Species Human (GRCh38)
Location 17:57148541-57148563
Sequence GGGGGGTGAGAGAAACTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149500470_1149500482 18 Left 1149500470 17:57148541-57148563 CCTAGAAGTTTCTCTCACCCCCC No data
Right 1149500482 17:57148582-57148604 GAAGAGGTCAGTGCCGTTATGGG No data
1149500470_1149500476 2 Left 1149500470 17:57148541-57148563 CCTAGAAGTTTCTCTCACCCCCC No data
Right 1149500476 17:57148566-57148588 CAAAGTCAGTACCCCCGAAGAGG No data
1149500470_1149500481 17 Left 1149500470 17:57148541-57148563 CCTAGAAGTTTCTCTCACCCCCC No data
Right 1149500481 17:57148581-57148603 CGAAGAGGTCAGTGCCGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149500470 Original CRISPR GGGGGGTGAGAGAAACTTCT AGG (reversed) Intergenic
No off target data available for this crispr