ID: 1149500471

View in Genome Browser
Species Human (GRCh38)
Location 17:57148558-57148580
Sequence GGGGTACTGACTTTGAAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149500471_1149500481 0 Left 1149500471 17:57148558-57148580 CCCCCCTTCAAAGTCAGTACCCC No data
Right 1149500481 17:57148581-57148603 CGAAGAGGTCAGTGCCGTTATGG No data
1149500471_1149500482 1 Left 1149500471 17:57148558-57148580 CCCCCCTTCAAAGTCAGTACCCC No data
Right 1149500482 17:57148582-57148604 GAAGAGGTCAGTGCCGTTATGGG No data
1149500471_1149500484 21 Left 1149500471 17:57148558-57148580 CCCCCCTTCAAAGTCAGTACCCC No data
Right 1149500484 17:57148602-57148624 GGGTTCTATCACCTAATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149500471 Original CRISPR GGGGTACTGACTTTGAAGGG GGG (reversed) Intergenic