ID: 1149500472

View in Genome Browser
Species Human (GRCh38)
Location 17:57148559-57148581
Sequence GGGGGTACTGACTTTGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149500472_1149500482 0 Left 1149500472 17:57148559-57148581 CCCCCTTCAAAGTCAGTACCCCC No data
Right 1149500482 17:57148582-57148604 GAAGAGGTCAGTGCCGTTATGGG No data
1149500472_1149500484 20 Left 1149500472 17:57148559-57148581 CCCCCTTCAAAGTCAGTACCCCC No data
Right 1149500484 17:57148602-57148624 GGGTTCTATCACCTAATGATTGG No data
1149500472_1149500481 -1 Left 1149500472 17:57148559-57148581 CCCCCTTCAAAGTCAGTACCCCC No data
Right 1149500481 17:57148581-57148603 CGAAGAGGTCAGTGCCGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149500472 Original CRISPR GGGGGTACTGACTTTGAAGG GGG (reversed) Intergenic
No off target data available for this crispr