ID: 1149500481

View in Genome Browser
Species Human (GRCh38)
Location 17:57148581-57148603
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149500472_1149500481 -1 Left 1149500472 17:57148559-57148581 CCCCCTTCAAAGTCAGTACCCCC No data
Right 1149500481 17:57148581-57148603 CGAAGAGGTCAGTGCCGTTATGG No data
1149500475_1149500481 -4 Left 1149500475 17:57148562-57148584 CCTTCAAAGTCAGTACCCCCGAA No data
Right 1149500481 17:57148581-57148603 CGAAGAGGTCAGTGCCGTTATGG No data
1149500473_1149500481 -2 Left 1149500473 17:57148560-57148582 CCCCTTCAAAGTCAGTACCCCCG No data
Right 1149500481 17:57148581-57148603 CGAAGAGGTCAGTGCCGTTATGG No data
1149500471_1149500481 0 Left 1149500471 17:57148558-57148580 CCCCCCTTCAAAGTCAGTACCCC No data
Right 1149500481 17:57148581-57148603 CGAAGAGGTCAGTGCCGTTATGG No data
1149500470_1149500481 17 Left 1149500470 17:57148541-57148563 CCTAGAAGTTTCTCTCACCCCCC No data
Right 1149500481 17:57148581-57148603 CGAAGAGGTCAGTGCCGTTATGG No data
1149500474_1149500481 -3 Left 1149500474 17:57148561-57148583 CCCTTCAAAGTCAGTACCCCCGA No data
Right 1149500481 17:57148581-57148603 CGAAGAGGTCAGTGCCGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149500481 Original CRISPR CGAAGAGGTCAGTGCCGTTA TGG Intergenic
No off target data available for this crispr