ID: 1149500484

View in Genome Browser
Species Human (GRCh38)
Location 17:57148602-57148624
Sequence GGGTTCTATCACCTAATGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149500475_1149500484 17 Left 1149500475 17:57148562-57148584 CCTTCAAAGTCAGTACCCCCGAA No data
Right 1149500484 17:57148602-57148624 GGGTTCTATCACCTAATGATTGG No data
1149500473_1149500484 19 Left 1149500473 17:57148560-57148582 CCCCTTCAAAGTCAGTACCCCCG No data
Right 1149500484 17:57148602-57148624 GGGTTCTATCACCTAATGATTGG No data
1149500474_1149500484 18 Left 1149500474 17:57148561-57148583 CCCTTCAAAGTCAGTACCCCCGA No data
Right 1149500484 17:57148602-57148624 GGGTTCTATCACCTAATGATTGG No data
1149500479_1149500484 0 Left 1149500479 17:57148579-57148601 CCCGAAGAGGTCAGTGCCGTTAT No data
Right 1149500484 17:57148602-57148624 GGGTTCTATCACCTAATGATTGG No data
1149500478_1149500484 1 Left 1149500478 17:57148578-57148600 CCCCGAAGAGGTCAGTGCCGTTA No data
Right 1149500484 17:57148602-57148624 GGGTTCTATCACCTAATGATTGG No data
1149500471_1149500484 21 Left 1149500471 17:57148558-57148580 CCCCCCTTCAAAGTCAGTACCCC No data
Right 1149500484 17:57148602-57148624 GGGTTCTATCACCTAATGATTGG No data
1149500477_1149500484 2 Left 1149500477 17:57148577-57148599 CCCCCGAAGAGGTCAGTGCCGTT No data
Right 1149500484 17:57148602-57148624 GGGTTCTATCACCTAATGATTGG No data
1149500472_1149500484 20 Left 1149500472 17:57148559-57148581 CCCCCTTCAAAGTCAGTACCCCC No data
Right 1149500484 17:57148602-57148624 GGGTTCTATCACCTAATGATTGG No data
1149500480_1149500484 -1 Left 1149500480 17:57148580-57148602 CCGAAGAGGTCAGTGCCGTTATG No data
Right 1149500484 17:57148602-57148624 GGGTTCTATCACCTAATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149500484 Original CRISPR GGGTTCTATCACCTAATGAT TGG Intergenic
No off target data available for this crispr