ID: 1149500530

View in Genome Browser
Species Human (GRCh38)
Location 17:57149110-57149132
Sequence GGTCGCAGTGGGGCACGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149500530_1149500541 21 Left 1149500530 17:57149110-57149132 CCCCCTCGTGCCCCACTGCGACC No data
Right 1149500541 17:57149154-57149176 CGGAGACACTGCTTTCTCTCAGG No data
1149500530_1149500539 1 Left 1149500530 17:57149110-57149132 CCCCCTCGTGCCCCACTGCGACC No data
Right 1149500539 17:57149134-57149156 TATCTGATAGGAAAATTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149500530 Original CRISPR GGTCGCAGTGGGGCACGAGG GGG (reversed) Intergenic
No off target data available for this crispr