ID: 1149501356

View in Genome Browser
Species Human (GRCh38)
Location 17:57155044-57155066
Sequence GTGGACTGATTGGGGCCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149501349_1149501356 26 Left 1149501349 17:57154995-57155017 CCTCTCTGGGCTGGGTCTTGTTC No data
Right 1149501356 17:57155044-57155066 GTGGACTGATTGGGGCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149501356 Original CRISPR GTGGACTGATTGGGGCCAAC TGG Intergenic
No off target data available for this crispr