ID: 1149503734

View in Genome Browser
Species Human (GRCh38)
Location 17:57175425-57175447
Sequence GCATGCACAAAGGATGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149503734_1149503738 27 Left 1149503734 17:57175425-57175447 CCATGTTCATCCTTTGTGCATGC No data
Right 1149503738 17:57175475-57175497 ACCCTGTGCCATTTGCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149503734 Original CRISPR GCATGCACAAAGGATGAACA TGG (reversed) Intergenic
No off target data available for this crispr