ID: 1149507061

View in Genome Browser
Species Human (GRCh38)
Location 17:57203268-57203290
Sequence CTGTACTTACAGAGGAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149507051_1149507061 30 Left 1149507051 17:57203215-57203237 CCTCATGCTGGTCTGTACCTCAC No data
Right 1149507061 17:57203268-57203290 CTGTACTTACAGAGGAGGCCTGG No data
1149507055_1149507061 13 Left 1149507055 17:57203232-57203254 CCTCACACTGGGGCATCAGTACC No data
Right 1149507061 17:57203268-57203290 CTGTACTTACAGAGGAGGCCTGG No data
1149507058_1149507061 -8 Left 1149507058 17:57203253-57203275 CCTCACAGAGGAGGTCTGTACTT No data
Right 1149507061 17:57203268-57203290 CTGTACTTACAGAGGAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149507061 Original CRISPR CTGTACTTACAGAGGAGGCC TGG Intergenic
No off target data available for this crispr