ID: 1149508465

View in Genome Browser
Species Human (GRCh38)
Location 17:57216214-57216236
Sequence GGTCCGGGTAGTGCTCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149508465_1149508468 -7 Left 1149508465 17:57216214-57216236 CCTGCAGGAGCACTACCCGGACC No data
Right 1149508468 17:57216230-57216252 CCGGACCTCAAAGTCAATATCGG No data
1149508465_1149508471 24 Left 1149508465 17:57216214-57216236 CCTGCAGGAGCACTACCCGGACC No data
Right 1149508471 17:57216261-57216283 TGCCTCAAGCTTCTGGCAGAAGG No data
1149508465_1149508470 17 Left 1149508465 17:57216214-57216236 CCTGCAGGAGCACTACCCGGACC No data
Right 1149508470 17:57216254-57216276 CAAAAACTGCCTCAAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149508465 Original CRISPR GGTCCGGGTAGTGCTCCTGC AGG (reversed) Intergenic
No off target data available for this crispr