ID: 1149510664

View in Genome Browser
Species Human (GRCh38)
Location 17:57238469-57238491
Sequence CAAGGTGGACTCATTGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149510664_1149510667 5 Left 1149510664 17:57238469-57238491 CCTACATCAATGAGTCCACCTTG No data
Right 1149510667 17:57238497-57238519 TAAATAATTGTCTTTTTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149510664 Original CRISPR CAAGGTGGACTCATTGATGT AGG (reversed) Intergenic
No off target data available for this crispr