ID: 1149514145

View in Genome Browser
Species Human (GRCh38)
Location 17:57267294-57267316
Sequence CTGCTACTGACTTGGAACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 1, 2: 3, 3: 8, 4: 106}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149514145_1149514152 -1 Left 1149514145 17:57267294-57267316 CCTATGTTCCAAGTCAGTAGCAG 0: 1
1: 1
2: 3
3: 8
4: 106
Right 1149514152 17:57267316-57267338 GGTGTCAGCTTAAGGAGGAGGGG 0: 1
1: 0
2: 2
3: 12
4: 176
1149514145_1149514148 -9 Left 1149514145 17:57267294-57267316 CCTATGTTCCAAGTCAGTAGCAG 0: 1
1: 1
2: 3
3: 8
4: 106
Right 1149514148 17:57267308-57267330 CAGTAGCAGGTGTCAGCTTAAGG 0: 1
1: 0
2: 1
3: 3
4: 128
1149514145_1149514151 -2 Left 1149514145 17:57267294-57267316 CCTATGTTCCAAGTCAGTAGCAG 0: 1
1: 1
2: 3
3: 8
4: 106
Right 1149514151 17:57267315-57267337 AGGTGTCAGCTTAAGGAGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 205
1149514145_1149514149 -6 Left 1149514145 17:57267294-57267316 CCTATGTTCCAAGTCAGTAGCAG 0: 1
1: 1
2: 3
3: 8
4: 106
Right 1149514149 17:57267311-57267333 TAGCAGGTGTCAGCTTAAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 107
1149514145_1149514150 -3 Left 1149514145 17:57267294-57267316 CCTATGTTCCAAGTCAGTAGCAG 0: 1
1: 1
2: 3
3: 8
4: 106
Right 1149514150 17:57267314-57267336 CAGGTGTCAGCTTAAGGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 195
1149514145_1149514154 29 Left 1149514145 17:57267294-57267316 CCTATGTTCCAAGTCAGTAGCAG 0: 1
1: 1
2: 3
3: 8
4: 106
Right 1149514154 17:57267346-57267368 TCCTACAAATGTCCTTTCCCTGG 0: 1
1: 0
2: 1
3: 24
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149514145 Original CRISPR CTGCTACTGACTTGGAACAT AGG (reversed) Intronic
900652202 1:3735208-3735230 CGGCTCCTGAAGTGGAACATGGG - Exonic
903280662 1:22248126-22248148 CTGCTACAGGCTTGGAACATAGG + Intergenic
910180577 1:84478468-84478490 TTGCTACTGACTAGGAGCATTGG + Intergenic
910836313 1:91516445-91516467 CTGCTATTCACTTGGATTATGGG + Intronic
912223723 1:107707334-107707356 CTGCTACTGATTTGCAAGTTAGG - Intronic
912415592 1:109506507-109506529 CTGCCACAGACGTGGTACATGGG - Exonic
917076613 1:171212764-171212786 CTGCTCCTGACCTGCAACTTTGG + Intergenic
918636655 1:186782803-186782825 CTGCTGCTGACTCGGAAGAAGGG + Intergenic
920266726 1:204729653-204729675 CTGCTGCTGACCTGGAACTGGGG + Intergenic
923420499 1:233810290-233810312 CTGCTCATGACTTGGGACAATGG - Intergenic
1065782422 10:29182440-29182462 CTGCTATTGCCTGGGAACTTCGG - Intergenic
1066323351 10:34327812-34327834 CTGTAACTGAGTTGGACCATCGG + Intronic
1070559297 10:77553713-77553735 CTGCTGCTGACCTTGAACCTGGG - Intronic
1076338301 10:129725368-129725390 CGGCTACTGACATGGAACTTCGG - Intronic
1078156612 11:8805374-8805396 GTGCTTGTGACTTGGAACACAGG - Intronic
1081961364 11:47140008-47140030 CCTCTATTGACTTGGAAGATGGG + Intronic
1082969725 11:59006734-59006756 CTTCTACTGCCTTGGCACCTTGG - Intronic
1086181555 11:83957390-83957412 CTGCTCTTCACGTGGAACATGGG + Intronic
1089742530 11:120594635-120594657 CTTCTGCTGACATGGAAGATGGG - Intronic
1093766826 12:22973387-22973409 CTCCTACTGGCTTGGGACATTGG - Intergenic
1093876181 12:24352218-24352240 ATGCTACTGACTAGCTACATGGG + Intergenic
1094138805 12:27158989-27159011 ATGCTACTGATTTTGTACATTGG - Intergenic
1098606080 12:72391799-72391821 CTGCTACAGACATGGAATGTTGG - Intronic
1101193382 12:102357870-102357892 CTGCTTATGAGTTGGAATATGGG + Intergenic
1103922963 12:124408932-124408954 CTGCCGCTGACTTGGAACTGGGG - Intronic
1103988447 12:124782489-124782511 CTGCTATTCACTCAGAACATAGG + Intronic
1104047190 12:125171727-125171749 CTGCTGCTGGCTTTGAAGATGGG - Intergenic
1105051055 12:133051423-133051445 CTTCTAGTGACTCTGAACATAGG - Intronic
1110208869 13:72949209-72949231 CTGAGACTGATTTGGAAGATTGG + Intronic
1112359673 13:98706123-98706145 CTTCTACTTACTTGAGACATTGG + Exonic
1114399931 14:22400693-22400715 CTGTTACTGACTTGGGAACTTGG - Intergenic
1116100392 14:40426350-40426372 CTGATGCTGACGTGGCACATAGG - Intergenic
1122761414 14:104031131-104031153 TTTCTACTGACTTGGAAAAGAGG - Exonic
1122947292 14:105018324-105018346 CTGCTGGAGATTTGGAACATTGG - Intronic
1124786836 15:32689558-32689580 CTGCTACTCACATGGAAAACAGG + Intronic
1125279417 15:38027707-38027729 CTGCTACTGCCCTTGACCATGGG - Intergenic
1126120473 15:45247024-45247046 TTGCTACTGACTTGGGTCAGAGG - Intergenic
1129464349 15:75715617-75715639 CTCCCACTGTCTTGGAACAAAGG + Intergenic
1129720899 15:77877395-77877417 CTCCCACTGTCTTGGAACAAAGG - Intergenic
1130484608 15:84391752-84391774 CTGAAAGTGACTTGGAAGATTGG + Intergenic
1133966052 16:10532391-10532413 CTGCTTCTCACTTGGAACTTGGG + Exonic
1135288489 16:21214338-21214360 CAGCAACTGACTTTGAACACAGG + Exonic
1137001169 16:35232428-35232450 CTGCTGCTGTCCAGGAACATGGG - Intergenic
1137268916 16:46889988-46890010 CTGCTTCTGCCTTGGAATCTGGG + Intronic
1138461755 16:57152933-57152955 CAGCTACTGACTTTGAACATGGG - Exonic
1138465211 16:57185513-57185535 CTGCTACTCACTTGAAACCTGGG + Intronic
1145944378 17:28762005-28762027 TTGGTACTAACTTGGAACAAAGG - Intronic
1147443150 17:40459764-40459786 CTCCCACTGACTTGGAGCAGGGG + Intergenic
1148948905 17:51291413-51291435 CTGCTACTGACTTGGAATATCGG - Intronic
1149514145 17:57267294-57267316 CTGCTACTGACTTGGAACATAGG - Intronic
1150578708 17:66453171-66453193 GAGCTCCTGACTTGGAACAGAGG + Intronic
1155369142 18:25079540-25079562 CTGCTACTGAATTGTAAAACTGG - Intronic
1160376696 18:78419338-78419360 CTACTACTAATTTGGAACAGTGG + Intergenic
1161982252 19:7636166-7636188 CTGCCACTTACATGGGACATAGG - Intronic
1162073874 19:8171721-8171743 CTGCTAATGTCTGGGATCATTGG + Intronic
1166620813 19:44298437-44298459 CTGCTACTGCATTGCAACCTGGG - Intronic
927324022 2:21782252-21782274 TTGCTACTGACTTCCAACGTGGG + Intergenic
930438720 2:51379544-51379566 TTGCCACTTACCTGGAACATGGG - Intergenic
932852973 2:75204909-75204931 ATGCTACTGATTTTGTACATTGG + Intergenic
933856074 2:86415767-86415789 ATGCTGCTGACTTTGAAGATGGG - Intergenic
934072380 2:88396415-88396437 CTGATACAGACTTGAAATATTGG - Intergenic
937735813 2:125287489-125287511 CTGCTACTGCCCTTGAGCATTGG - Intergenic
937950255 2:127380734-127380756 CTGGGATTGATTTGGAACATTGG - Intronic
938698629 2:133857102-133857124 CTGTTAGTGACTTAGACCATGGG + Intergenic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
943198286 2:184784566-184784588 CTGCTACTATCTTGGGACACTGG - Intronic
943520394 2:188942646-188942668 CTACTGCTGACTTTGAAGATGGG - Intergenic
944225791 2:197347537-197347559 CTGATACAGATTTGGAACAATGG - Intergenic
944659758 2:201911558-201911580 CTGTTGCTGGCTTTGAACATGGG + Intergenic
946699662 2:222399394-222399416 TTTCTACTTACTGGGAACATTGG - Intergenic
947557951 2:231114153-231114175 CTGCTGCTGACTTAGAAAAAAGG - Intronic
1169135438 20:3194435-3194457 GTGCTCCTGACTGGGAACTTGGG - Intronic
1175834883 20:61987064-61987086 CTGCTGCTGACTTTGAAGCTTGG - Intronic
1179188485 21:39103703-39103725 CTGCTACTGACTTGGATTTCAGG - Intergenic
1182177368 22:28304735-28304757 CTGCTGCTGCCTTAGAATATTGG - Intronic
949685795 3:6568589-6568611 CTGAGACTGACTTGGAGCTTAGG - Intergenic
952697165 3:36279447-36279469 CTATTACTGACTTTGAAGATGGG + Intergenic
957147053 3:76437811-76437833 CTGCTAATGACATGGAAAAAGGG - Intronic
959717896 3:109453410-109453432 CTGCTAGTGAGATGGCACATTGG + Intergenic
966565462 3:181375807-181375829 CAGCTATTTACTTGGAAGATGGG + Intergenic
966917168 3:184591385-184591407 CTTGTACTGACCTTGAACATAGG + Intronic
974313805 4:60250318-60250340 CTGCTACTTACGTGTAGCATGGG - Intergenic
974699739 4:65425718-65425740 CTGCTGCTGACTTGAACCAGTGG + Intronic
981974171 4:150703463-150703485 CTGGTATAGGCTTGGAACATAGG - Intronic
983986129 4:174062273-174062295 CTTCTCCTGACCTGGGACATTGG + Intergenic
986274876 5:6265211-6265233 CTGGGACTGACTTGGTACAATGG - Intergenic
987962971 5:24834301-24834323 CTTCTTCTGTCCTGGAACATTGG + Intergenic
988451433 5:31347459-31347481 CTGTAACTGACTTGTAAAATTGG + Intergenic
997932790 5:138086023-138086045 CTGCTTCTGACTGGGAAGTTTGG - Intronic
999436489 5:151567468-151567490 CTGCCACTGACCGGGATCATGGG - Exonic
999696588 5:154192454-154192476 CTGGTACTGAATAGGAACAGAGG - Intronic
1004200803 6:13546189-13546211 CTGCTTCTGACATGGAAAACAGG - Intergenic
1012280309 6:97320700-97320722 CTGCTACTGAATGGAAACATGGG + Intergenic
1020976405 7:15012478-15012500 CTGCTCCTGCTTTGGAACATTGG + Intergenic
1022846618 7:34216275-34216297 CTTCTCCTGTCCTGGAACATTGG - Intergenic
1026469377 7:70681830-70681852 CTGGGACTAAGTTGGAACATAGG - Intronic
1042259644 8:66844900-66844922 ATGCTACTGACTTAGAACATTGG + Intronic
1043523452 8:81071728-81071750 GTGCTACTTACTTGTAACTTGGG - Intronic
1046349815 8:112993164-112993186 CTGTTATTTATTTGGAACATTGG - Intronic
1047441940 8:124886337-124886359 CTGCCACTGATTTGGCAAATGGG - Intergenic
1048508320 8:135040786-135040808 CTGCTGCTGGCTTTGAAGATGGG - Intergenic
1049402106 8:142433002-142433024 CTGCCGCTGGCTTTGAACATGGG + Intergenic
1053561178 9:39195548-39195570 CTGCAACTGAATTTTAACATTGG - Intronic
1053825275 9:42015783-42015805 CTGCAACTGAATTTTAACATTGG - Intronic
1054135941 9:61423399-61423421 CTGCAACTGAATTTTAACATTGG + Intergenic
1054605292 9:67171574-67171596 CTGCAACTGAATTTTAACATTGG + Intergenic
1054823567 9:69548149-69548171 CTGCTGCTGACTTGGAAGACGGG + Intronic
1057009030 9:91585161-91585183 CTGCTTCTCACATGTAACATGGG + Intronic
1057839757 9:98476843-98476865 CTGCTATAGACTTGGAAAGTAGG + Intronic
1057845753 9:98521180-98521202 CTGCTTCAGCCTTGGAAAATAGG + Intronic
1061147112 9:128806481-128806503 CTGCCACTGACCTGGAATGTTGG + Intronic
1185833585 X:3323748-3323770 CTGTCACTGACTTGGACCTTTGG + Exonic
1190106838 X:47567065-47567087 CTGCTGGTGACTTGGAATGTGGG - Exonic
1194996586 X:100597685-100597707 CTGTTACTGTCTTAGAAAATAGG - Intronic
1195851307 X:109284705-109284727 CTGCTAATAACAGGGAACATGGG - Intergenic
1197588121 X:128374555-128374577 CGACTACTCACTTTGAACATGGG - Intergenic
1201242135 Y:11969287-11969309 CTGTCACTGACTTGGACCTTTGG - Intergenic
1201398241 Y:13573000-13573022 CTGCTTCAGACTTGGGAGATTGG - Intergenic
1201458710 Y:14199356-14199378 CTGAAACTGAATTTGAACATTGG - Intergenic