ID: 1149516880

View in Genome Browser
Species Human (GRCh38)
Location 17:57287609-57287631
Sequence AGCACCACAGGCCTCTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 329}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149516880_1149516884 3 Left 1149516880 17:57287609-57287631 CCAGGGAAGAGGCCTGTGGTGCT 0: 1
1: 0
2: 4
3: 29
4: 329
Right 1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG 0: 1
1: 0
2: 0
3: 3
4: 29
1149516880_1149516885 4 Left 1149516880 17:57287609-57287631 CCAGGGAAGAGGCCTGTGGTGCT 0: 1
1: 0
2: 4
3: 29
4: 329
Right 1149516885 17:57287636-57287658 TGCCTTTCGGCTCCTACGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 32
1149516880_1149516882 -9 Left 1149516880 17:57287609-57287631 CCAGGGAAGAGGCCTGTGGTGCT 0: 1
1: 0
2: 4
3: 29
4: 329
Right 1149516882 17:57287623-57287645 TGTGGTGCTTCTCTGCCTTTCGG 0: 1
1: 0
2: 6
3: 28
4: 267
1149516880_1149516889 30 Left 1149516880 17:57287609-57287631 CCAGGGAAGAGGCCTGTGGTGCT 0: 1
1: 0
2: 4
3: 29
4: 329
Right 1149516889 17:57287662-57287684 TGGAAAGCCCTTTCCCTGCCTGG 0: 1
1: 1
2: 1
3: 42
4: 265
1149516880_1149516883 2 Left 1149516880 17:57287609-57287631 CCAGGGAAGAGGCCTGTGGTGCT 0: 1
1: 0
2: 4
3: 29
4: 329
Right 1149516883 17:57287634-57287656 TCTGCCTTTCGGCTCCTACGTGG 0: 1
1: 0
2: 0
3: 10
4: 55
1149516880_1149516887 10 Left 1149516880 17:57287609-57287631 CCAGGGAAGAGGCCTGTGGTGCT 0: 1
1: 0
2: 4
3: 29
4: 329
Right 1149516887 17:57287642-57287664 TCGGCTCCTACGTGGGGCATTGG 0: 1
1: 0
2: 0
3: 4
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149516880 Original CRISPR AGCACCACAGGCCTCTTCCC TGG (reversed) Intronic