ID: 1149516880

View in Genome Browser
Species Human (GRCh38)
Location 17:57287609-57287631
Sequence AGCACCACAGGCCTCTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 329}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149516880_1149516889 30 Left 1149516880 17:57287609-57287631 CCAGGGAAGAGGCCTGTGGTGCT 0: 1
1: 0
2: 4
3: 29
4: 329
Right 1149516889 17:57287662-57287684 TGGAAAGCCCTTTCCCTGCCTGG 0: 1
1: 1
2: 1
3: 42
4: 265
1149516880_1149516882 -9 Left 1149516880 17:57287609-57287631 CCAGGGAAGAGGCCTGTGGTGCT 0: 1
1: 0
2: 4
3: 29
4: 329
Right 1149516882 17:57287623-57287645 TGTGGTGCTTCTCTGCCTTTCGG 0: 1
1: 0
2: 6
3: 28
4: 267
1149516880_1149516883 2 Left 1149516880 17:57287609-57287631 CCAGGGAAGAGGCCTGTGGTGCT 0: 1
1: 0
2: 4
3: 29
4: 329
Right 1149516883 17:57287634-57287656 TCTGCCTTTCGGCTCCTACGTGG 0: 1
1: 0
2: 0
3: 10
4: 55
1149516880_1149516885 4 Left 1149516880 17:57287609-57287631 CCAGGGAAGAGGCCTGTGGTGCT 0: 1
1: 0
2: 4
3: 29
4: 329
Right 1149516885 17:57287636-57287658 TGCCTTTCGGCTCCTACGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 32
1149516880_1149516884 3 Left 1149516880 17:57287609-57287631 CCAGGGAAGAGGCCTGTGGTGCT 0: 1
1: 0
2: 4
3: 29
4: 329
Right 1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG 0: 1
1: 0
2: 0
3: 3
4: 29
1149516880_1149516887 10 Left 1149516880 17:57287609-57287631 CCAGGGAAGAGGCCTGTGGTGCT 0: 1
1: 0
2: 4
3: 29
4: 329
Right 1149516887 17:57287642-57287664 TCGGCTCCTACGTGGGGCATTGG 0: 1
1: 0
2: 0
3: 4
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149516880 Original CRISPR AGCACCACAGGCCTCTTCCC TGG (reversed) Intronic
900500873 1:3003886-3003908 AGCACCCCCGGCCTCACCCCGGG - Intergenic
901415460 1:9113166-9113188 TGCACCACAGGCCTGAACCCTGG - Intronic
901629236 1:10640281-10640303 GGCCACACAGGCCTCTCCCCCGG + Intronic
901680109 1:10908119-10908141 AGCCGCACAGCCTTCTTCCCTGG - Intergenic
901925785 1:12565257-12565279 AGGACCCAAGTCCTCTTCCCAGG + Intergenic
902689952 1:18104874-18104896 GGCAGGACAGGCCTCTTCCTCGG - Intergenic
903332206 1:22601914-22601936 GCCACCAAAGGCCCCTTCCCAGG - Exonic
903788058 1:25874707-25874729 AGCCCCACAGGCCTCCTCCAGGG + Intergenic
905396106 1:37667667-37667689 AGGACCACTGGCAGCTTCCCGGG - Intergenic
905936374 1:41827485-41827507 AGTGCCTCAGGCATCTTCCCTGG - Intronic
907358777 1:53898002-53898024 AACACCATGGGCCTCTGCCCTGG + Intronic
908224530 1:62042688-62042710 AGCACCACAGAACTCTAGCCTGG - Intronic
912523758 1:110265709-110265731 ACCTCCAAGGGCCTCTTCCCTGG - Intronic
912658358 1:111507602-111507624 GGCTCCAGAGGCCTTTTCCCTGG - Intronic
914756389 1:150563915-150563937 CCCAGCACAGGGCTCTTCCCAGG - Intergenic
915903239 1:159861204-159861226 ATCACCACTGTCCTCTTCCTTGG - Intronic
917293695 1:173496326-173496348 GGCACCAGAGACCTCTTTCCTGG + Intergenic
917515901 1:175708185-175708207 ATAGCCACAGGCCTCTGCCCTGG + Intronic
917706994 1:177644982-177645004 AGTAGCACAGGCCCCTTCCAAGG - Intergenic
917965788 1:180177702-180177724 AGCCTCTCAGACCTCTTCCCTGG - Intronic
918100285 1:181366829-181366851 AGCACCACAGGGGTCTTCAAAGG - Intergenic
919796749 1:201325521-201325543 AGCACCCCAGGACTCTCCTCAGG - Intronic
919879354 1:201891816-201891838 GCCACCACAGCCCTCTTACCCGG + Exonic
919935498 1:202248113-202248135 AGCACACCAGGCTCCTTCCCTGG + Intronic
920209823 1:204320144-204320166 AGAACCAGCTGCCTCTTCCCTGG + Intronic
920252461 1:204630727-204630749 AGTCCCACAGGCCTCTCCCTGGG + Intronic
920452863 1:206073202-206073224 AGCACCTCAGGGCTCTGTCCTGG + Intronic
921625619 1:217374890-217374912 ACCTACACAGGCCTCTTCCTGGG + Intergenic
923273179 1:232375531-232375553 AGCATCACAGTATTCTTCCCTGG + Intergenic
923391464 1:233516763-233516785 TGCACCACAAGCAGCTTCCCTGG - Intergenic
924521603 1:244810703-244810725 GGCACCACAGCCCTCCTGCCTGG + Intergenic
1063671509 10:8103329-8103351 AGCAGCTCCGCCCTCTTCCCGGG - Intergenic
1064198411 10:13264246-13264268 TGCACCACAGCACTCTACCCTGG - Intergenic
1064919688 10:20503140-20503162 AGAACCACAGCCCACTGCCCTGG + Intergenic
1067753298 10:48985793-48985815 TGCACCCCAGGCCTCTGCCCTGG - Intergenic
1068809907 10:61243707-61243729 AGGTCCACAGACCTATTCCCTGG - Intergenic
1071566016 10:86671631-86671653 AGCTCCAAAGGCCTCTGCCCTGG + Intronic
1072468887 10:95693652-95693674 AGGTCCACAGTCCTATTCCCAGG + Exonic
1072739144 10:97899257-97899279 AGCAGCAGAAGCCACTTCCCAGG - Intronic
1075191008 10:120308530-120308552 AGGACCACTGGGCTTTTCCCTGG + Intergenic
1075334275 10:121597585-121597607 AGCCCCGCAGGCCGGTTCCCGGG - Intronic
1075588737 10:123676442-123676464 AGCATCCCTGGCCTCTACCCAGG + Intronic
1076300439 10:129421581-129421603 AGCACCTCTGGCTTCCTCCCTGG + Intergenic
1076564728 10:131390340-131390362 AGCACCATAGTCCTCTGGCCTGG + Intergenic
1076629787 10:131845654-131845676 AGCTCCGCAGGCCTCGTCCTGGG + Intergenic
1076629806 10:131845741-131845763 AGCTCCGCAGGCCTCCTCCCTGG + Intergenic
1076658824 10:132041791-132041813 CCCACCTCAGGCCTCTTCCATGG + Intergenic
1076721039 10:132393343-132393365 AGCACGCCAGGCCTCCTCCAAGG - Intergenic
1077211077 11:1371234-1371256 AGCACCACAGGGCTCTCCCGGGG + Intergenic
1077350558 11:2091283-2091305 AGCCCCACAGGCCTCCGACCGGG - Intergenic
1077451686 11:2652119-2652141 AGAAACACAGGTCCCTTCCCAGG - Intronic
1077587093 11:3462126-3462148 AGCTCCCCAGGCTCCTTCCCAGG - Intergenic
1078170549 11:8925950-8925972 AGCACCCCAGGCCCCTTCACTGG - Exonic
1078548072 11:12260778-12260800 AGCAAAACAGTCCTCCTCCCAGG - Intronic
1080839340 11:35969795-35969817 GGCCCCACATGCCTCCTCCCTGG - Intronic
1081750328 11:45506050-45506072 CTCCCCACAAGCCTCTTCCCAGG + Intergenic
1082195390 11:49298499-49298521 AGGGCCTCAGGCCTCTGCCCAGG + Intergenic
1083623061 11:64058475-64058497 AGCAGGTCAGGCCTTTTCCCAGG + Intronic
1083676436 11:64328131-64328153 AGGACAACAGCCCTCTTTCCTGG + Intergenic
1084115964 11:67043102-67043124 GGCACCACTGACCTCCTCCCAGG - Intronic
1084243088 11:67836138-67836160 AGCTCCCCAGGCTCCTTCCCAGG - Intergenic
1084640652 11:70423915-70423937 AGGACCACACCCCTCTGCCCAGG - Intronic
1084829902 11:71760804-71760826 AGCTCCCCAGGCTCCTTCCCAGG + Intergenic
1086121029 11:83304467-83304489 AGCACCTCCTGCCTCTCCCCAGG - Intergenic
1086660542 11:89411053-89411075 AGGGCCTCAGGCCTCTGCCCAGG - Intronic
1087308277 11:96508944-96508966 AGCATTACAGGTCTCTTTCCAGG + Intergenic
1089368082 11:117933158-117933180 AGCAAGGAAGGCCTCTTCCCAGG + Intergenic
1091416908 12:295748-295770 GGCACCAAAGGGCTCTTCCGAGG + Exonic
1092413334 12:8270873-8270895 AGCACCCCAGGCTCCTTCCCAGG - Intergenic
1095145539 12:38721815-38721837 CGCACCACAAGCAGCTTCCCTGG - Intronic
1096592254 12:52668095-52668117 GGCACTATAGGCCCCTTCCCTGG - Intergenic
1097911641 12:64976388-64976410 AGCACCATGGGACTTTTCCCAGG + Intergenic
1101068655 12:101049884-101049906 AGAACCTCAGGCCTTTTCCCAGG - Intronic
1101282754 12:103276414-103276436 AGCTCTAGAGACCTCTTCCCTGG + Intronic
1101445138 12:104732075-104732097 AGCAGCGCAATCCTCTTCCCTGG - Intronic
1101646301 12:106633843-106633865 GGGACCACATGCATCTTCCCTGG + Intronic
1101775039 12:107785995-107786017 CGCACCACTGGACTCCTCCCTGG - Intergenic
1102754569 12:115326991-115327013 AGCACCCCTGGCCTTTTCCAAGG - Intergenic
1112219329 13:97471941-97471963 TGTATCACAGCCCTCTTCCCAGG - Intergenic
1113657798 13:112079738-112079760 AGCAACGCCGGCCACTTCCCAGG + Intergenic
1114270410 14:21097623-21097645 AGCACCCCAGACCCCTCCCCAGG + Intronic
1114278613 14:21169837-21169859 AGGAGCCCAGCCCTCTTCCCTGG + Intergenic
1114355921 14:21907952-21907974 GGGGCTACAGGCCTCTTCCCTGG + Intergenic
1116329649 14:43579171-43579193 GGCACCACAGACCCCTTTCCTGG + Intergenic
1117690277 14:58298929-58298951 AGCCCCACAGCCATTTTCCCGGG - Intronic
1118443704 14:65833648-65833670 AGCATAACAGGACTCCTCCCTGG - Intergenic
1118907193 14:70031646-70031668 GGCATCACAGGCATCTTCCGCGG + Intronic
1119210872 14:72830928-72830950 CGCACCTCGGGCCTCTGCCCTGG + Intronic
1121322172 14:92998338-92998360 AGAACCACAGCCCCCTTCCATGG - Intronic
1121341059 14:93105428-93105450 AGCTCCCCAGCCCCCTTCCCAGG + Intronic
1121539584 14:94715128-94715150 AGCACCCCTGGCCTCCACCCAGG - Intergenic
1121570671 14:94944511-94944533 AGCTCCACCGGACTCTACCCAGG + Intergenic
1122275976 14:100590994-100591016 AGCAGCAGTGGCCTCCTCCCTGG + Intergenic
1122505034 14:102226835-102226857 AGCTCCACAGGCCCCCTCCATGG - Intronic
1123479138 15:20614996-20615018 AGCACCACAGTGCCCTTTCCTGG - Intergenic
1123638875 15:22385389-22385411 AGCACCACAGTGCCCTTTCCTGG + Intergenic
1124102317 15:26707223-26707245 AGCAGGACAGGCATGTTCCCAGG + Intronic
1124127185 15:26946680-26946702 AGCTCACCATGCCTCTTCCCAGG + Intronic
1124374708 15:29122683-29122705 CGCAACACCGGCCTGTTCCCTGG + Exonic
1125549932 15:40537520-40537542 TGAACCTCTGGCCTCTTCCCTGG - Intronic
1126131734 15:45348449-45348471 AGCCTCACAGGCCTCCTCGCTGG - Intergenic
1127974640 15:63988121-63988143 AGGAACACACCCCTCTTCCCAGG + Intronic
1128380293 15:67107381-67107403 AGCACCCCACCCTTCTTCCCAGG + Intronic
1128545575 15:68565448-68565470 TGCTCCACAGGCCTCTTCTGTGG + Intergenic
1129159667 15:73740298-73740320 AGCACCAAAGGCCTCCTCACTGG + Exonic
1129780278 15:78265089-78265111 CGCACCACATGCCTCCTCCGCGG - Intronic
1130795647 15:87206621-87206643 AGCATCACAGGCCCCCTCCTAGG + Intergenic
1132294440 15:100725213-100725235 AGCACCGCGGGTCCCTTCCCTGG - Intergenic
1132476623 16:142410-142432 ACCACCACCGGCCACTGCCCTGG - Intergenic
1133354545 16:5126378-5126400 AGCTCCCCAGGCTCCTTCCCAGG - Intergenic
1134689068 16:16179072-16179094 AGCTCAACATGCCTATTCCCTGG + Intronic
1134941539 16:18293379-18293401 AGCACTCCAGGCCTCTACCTGGG + Intergenic
1135576163 16:23587510-23587532 AGCATCTCAGGCCTCCTTCCTGG + Intronic
1136004232 16:27317553-27317575 AGCACCTCAAGCCTCTGCCGGGG - Intronic
1137702975 16:50510503-50510525 ACCACCACCCCCCTCTTCCCAGG - Intergenic
1138271373 16:55698327-55698349 AGCACCACAGCCCTATGCCCTGG + Intronic
1138515853 16:57535305-57535327 GGCACCCCTGGCCTATTCCCAGG + Intronic
1138529487 16:57627340-57627362 AGCACCCCAGGCCTCAGCCTGGG - Intronic
1139301323 16:65947728-65947750 CGCACCACTGCACTCTTCCCTGG + Intergenic
1139936386 16:70574540-70574562 CGCACCACAGCCCTCTAGCCTGG - Exonic
1141677124 16:85523835-85523857 AACACCACGGGGCTCTTGCCTGG + Intergenic
1143514829 17:7414355-7414377 AGCATCACAGGCTTCTTCCCAGG - Exonic
1144068219 17:11642756-11642778 AGCCCCACAGGCCCCAACCCCGG - Intronic
1144155307 17:12494519-12494541 AGCATCAGAGGCATCCTCCCTGG + Intergenic
1146121963 17:30203641-30203663 TTCAGCACAGGCCTCTGCCCAGG + Intronic
1147544238 17:41387764-41387786 TTCACCACAGCCCTCTCCCCCGG - Intronic
1147779374 17:42929223-42929245 AGAAACATTGGCCTCTTCCCAGG + Intergenic
1148451268 17:47779182-47779204 AGGACCAATGGCCTCTTTCCAGG + Intergenic
1149516880 17:57287609-57287631 AGCACCACAGGCCTCTTCCCTGG - Intronic
1151568623 17:74914975-74914997 GGCACCCCAGGCTTCTGCCCTGG + Intergenic
1151678318 17:75611082-75611104 AGCACCCCGGTCCTCTTCTCAGG - Intergenic
1151784604 17:76269316-76269338 AGCCCCTCAGTCCTCTTCCTGGG - Intronic
1151886430 17:76925718-76925740 CCCACCCCGGGCCTCTTCCCTGG + Intronic
1151886699 17:76926898-76926920 AGCACCAGAGGCTTCCTTCCTGG - Intronic
1152706053 17:81844244-81844266 AGCTACACAGGGGTCTTCCCAGG + Intronic
1152730167 17:81966307-81966329 AGCACCACAGTGCCCATCCCAGG + Intergenic
1152739054 17:82011174-82011196 AGCACCACTGCCCTCCTCCCGGG - Intronic
1152751703 17:82065411-82065433 AGGACCCCCGGCCCCTTCCCGGG + Exonic
1152937028 17:83145122-83145144 AGCACCGCAGGCAGCATCCCTGG - Intergenic
1153472421 18:5461974-5461996 AGCACCAGATGCCTCCTGCCAGG + Intronic
1155546753 18:26923885-26923907 AGCTCCTCAGTCATCTTCCCAGG - Intronic
1155663642 18:28281651-28281673 AGCATCTCAAGCCTCTCCCCAGG - Intergenic
1156326736 18:36080252-36080274 GGCATCACAGGACTCTTCACAGG + Intergenic
1156339672 18:36200071-36200093 AGCAGCACAAACCACTTCCCAGG - Exonic
1157403580 18:47405700-47405722 TGCACCACTGGCCTCTGGCCAGG - Intergenic
1157593584 18:48850677-48850699 AACTCCACAGGCTTCCTCCCTGG - Intronic
1158867487 18:61651991-61652013 AGCTCCACAGGCAGCTTCTCTGG - Intergenic
1160006477 18:75072696-75072718 AGCAGCCCAGTCCTCTGCCCTGG + Intergenic
1160493025 18:79353668-79353690 CGCATCACAGGCCTCGTCCTTGG + Intronic
1160533160 18:79577166-79577188 AGCACCACAGGCCACATGGCCGG + Intergenic
1160697312 19:491441-491463 AGCCGCACAGGCCTCTCCCGAGG - Intronic
1161041777 19:2114332-2114354 AGCACCACTGGCCACCCCCCAGG + Intronic
1162552161 19:11364009-11364031 AGCACCCCCGTCTTCTTCCCAGG + Intronic
1163021492 19:14483034-14483056 GGCACCCAAGGCCTCTGCCCAGG - Intronic
1163034279 19:14562429-14562451 GCCACCCCAGGCCTCCTCCCTGG + Intronic
1163628405 19:18403855-18403877 GGCTCCACTGGCCTCATCCCTGG + Intergenic
1164158685 19:22612233-22612255 AGGACTAGATGCCTCTTCCCTGG - Intergenic
1164504632 19:28849589-28849611 AGCATCACAGGCAATTTCCCTGG + Intergenic
1166266690 19:41688762-41688784 TCCACCACAGCTCTCTTCCCAGG - Intronic
1167289578 19:48616950-48616972 AACCCCACAGGCCTCTCCTCAGG + Intronic
1167689970 19:50979524-50979546 AGCACCTCAGTCTCCTTCCCTGG + Intronic
1167859792 19:52273495-52273517 AGCCACACAGACCTCTTTCCTGG + Intronic
1168131237 19:54320841-54320863 AGCACCACCTGCCTCTTCAGTGG - Intergenic
1168331276 19:55570670-55570692 AGCACCACTGGACTCTAGCCTGG + Intergenic
1168469736 19:56630390-56630412 AAAACCCCAGGCCTCTGCCCTGG - Intergenic
1168470673 19:56638283-56638305 AGCACCACAGGCAGCCCCCCAGG + Intergenic
925121121 2:1419306-1419328 TGCATCAGACGCCTCTTCCCTGG + Intronic
925330472 2:3054694-3054716 AGCACTCCAGGCATCATCCCAGG + Intergenic
925848982 2:8062019-8062041 AGCACAGCAGGCCTGGTCCCAGG - Intergenic
926572154 2:14541601-14541623 GGCATAAGAGGCCTCTTCCCTGG - Intergenic
927692516 2:25218286-25218308 AGCACCTCAGCCCTTCTCCCTGG + Intergenic
927695776 2:25238865-25238887 AGCAGCACAGGACTCTTCTTTGG + Intronic
929018081 2:37521619-37521641 AGCACCAAAGGCCCATTCCAGGG - Intergenic
929187148 2:39107333-39107355 AGCATGGCAGGCCTGTTCCCGGG + Intronic
929822933 2:45287929-45287951 AGCACCACAGGGCTTTGCCAGGG - Intergenic
930836631 2:55801004-55801026 AGCATCCCTGGCCTCCTCCCTGG - Intergenic
932619019 2:73255097-73255119 GTCACCTCAGGCCTCTGCCCTGG + Exonic
933692532 2:85190412-85190434 AGCACCATAGGCCTCTGCAGAGG + Intronic
933720679 2:85395501-85395523 ACAACCACAGCCCTCTTCCTAGG - Intronic
933818763 2:86090672-86090694 AGCATCATAGGCATATTCCCTGG - Intronic
933899074 2:86836309-86836331 ACCCCCACAGGCCTCGGCCCTGG + Intronic
934173224 2:89557211-89557233 AGCCCCCCACTCCTCTTCCCAGG - Intergenic
934283539 2:91631568-91631590 AGCCCCCCACTCCTCTTCCCAGG - Intergenic
934605589 2:95692779-95692801 AGCAGCCCAGGCTTCCTCCCTGG - Intergenic
935659365 2:105452715-105452737 AGCACCACAGCACTCTAGCCTGG + Intergenic
936018281 2:108975688-108975710 ACCACCACAGGGCTCTGGCCAGG - Intronic
936091035 2:109501627-109501649 GGCCGCACAGGCCTCTTCCCGGG + Exonic
936106278 2:109627238-109627260 AGCACCACTGCACTCTACCCTGG - Intergenic
936539055 2:113335319-113335341 AGCAGCCCAGGCTTCCTCCCTGG - Intergenic
936947117 2:117941014-117941036 AGCACCACAGTGCTGCTCCCGGG + Intronic
938295871 2:130179165-130179187 AGCGCCACAGGACTCTAGCCTGG - Intronic
938370225 2:130763789-130763811 GGCACCACAGGCCTGCTCGCCGG + Exonic
938932061 2:136095205-136095227 GGCCTCAGAGGCCTCTTCCCTGG - Intergenic
938949606 2:136244367-136244389 TGCACCACACGCCTGTCCCCAGG - Intergenic
940138094 2:150461837-150461859 ACCATCACAGGGCTATTCCCTGG - Intergenic
941345435 2:164362633-164362655 AGCAAGACAGGCAACTTCCCAGG - Intergenic
942413744 2:175737229-175737251 TGCTCCCCAGGCCTCTTCCTGGG - Intergenic
943731941 2:191311320-191311342 TGCACCACAGACCTCTACCTTGG + Intronic
945012808 2:205482700-205482722 GGCACCACTGGATTCTTCCCTGG + Intronic
946283099 2:218680640-218680662 AGCACCTCTGGCCTCTCCTCTGG - Exonic
947632598 2:231663657-231663679 TGGAGCACAGGCCTCTTTCCGGG + Intergenic
948200579 2:236127280-236127302 AGCACCCCAGTCCTGGTCCCTGG + Exonic
948226908 2:236318318-236318340 TGGGCCTCAGGCCTCTTCCCAGG - Intergenic
948453673 2:238093999-238094021 AGCACCACACCCCTCCTCTCTGG - Intronic
948771948 2:240255840-240255862 GGCACCACAGTCCTGATCCCTGG + Intergenic
1168890595 20:1293456-1293478 AGTCCCGCAGGCCTCTCCCCAGG - Intronic
1169010959 20:2250084-2250106 TGCACCACAGGACTCTGGCCTGG - Intergenic
1169785713 20:9357415-9357437 AGAACCATGGGGCTCTTCCCAGG + Intronic
1169945560 20:10984482-10984504 AGCAGCACAGGCATCCTCCCAGG - Intergenic
1170871428 20:20210112-20210134 ATCTCCACTGGACTCTTCCCAGG + Intronic
1171356252 20:24547647-24547669 GACAGCCCAGGCCTCTTCCCAGG + Intronic
1172973270 20:38888664-38888686 AGCCCTGCAGGCCCCTTCCCAGG - Intronic
1173800558 20:45891938-45891960 AGCACCACAGGGCTGTTCTCGGG - Exonic
1174061119 20:47833782-47833804 AGCAGCACTGGCCCCTCCCCAGG + Intergenic
1174070655 20:47896917-47896939 AGCAGCACTGGCCTCTCCCCAGG - Intergenic
1174070840 20:47897933-47897955 AGCAGTACCGGCCTCTCCCCAGG - Intergenic
1174100276 20:48121893-48121915 AGCAGCACTGGCCCCTCCCCGGG + Intergenic
1174100310 20:48122058-48122080 AGCAGTACCGGCCTCTCCCCAGG + Intergenic
1174100444 20:48122812-48122834 AGCAGCACTGGCCCCTCCCCAGG + Intergenic
1174100476 20:48122974-48122996 AGCAGTACCGGCCTCTCCCCAGG + Intergenic
1174153226 20:48500723-48500745 AGCAGTACCGGCCTCTCCCCAGG + Intergenic
1174153394 20:48501685-48501707 AGCAGCACTGGCCCCTCCCCAGG + Intergenic
1175319205 20:58073465-58073487 AGCACCCCAGGCCCCCGCCCAGG + Intergenic
1175767734 20:61602931-61602953 AGCACCTGAGGCCCCCTCCCTGG + Intronic
1177481283 21:21692731-21692753 AACACCACATCCCTTTTCCCAGG + Intergenic
1177869542 21:26554608-26554630 AGTACCACCTGCCTCTCCCCAGG - Intronic
1178705626 21:34870502-34870524 AGCACCCCTGGCCTCTACTCAGG - Intronic
1179998137 21:44983356-44983378 ATAATGACAGGCCTCTTCCCTGG + Intergenic
1180150944 21:45947519-45947541 AGCACTACCGGCCCATTCCCCGG + Intergenic
1180214036 21:46313642-46313664 AGCACCAGAAACCTCCTCCCAGG - Intronic
1180637534 22:17272769-17272791 GGCCCCTCTGGCCTCTTCCCTGG + Intergenic
1181450198 22:23014711-23014733 ATCAACACAGCCCTCTTCTCTGG + Intergenic
1181696353 22:24594715-24594737 GGCACCACAGGTTTCCTCCCTGG + Intronic
1182216356 22:28721772-28721794 TGCACCACTGTACTCTTCCCTGG - Intronic
1182413930 22:30209060-30209082 AGAACCACGGTCCTCTTTCCGGG - Intergenic
1183475193 22:38032344-38032366 TCCACCACAGCCATCTTCCCAGG + Intronic
1184758790 22:46533388-46533410 AGAACCGCAGGCCTGCTCCCAGG + Intronic
1185163115 22:49241420-49241442 CGCAACACCGGCCCCTTCCCAGG + Intergenic
1185319686 22:50194811-50194833 AGCACCAGGGGCCCCATCCCAGG - Intronic
1185408920 22:50672737-50672759 AGCATCACAGGCCCCTCCCAAGG - Intergenic
949306865 3:2651744-2651766 AGCACCACTGCCCTCTAGCCTGG - Intronic
950062960 3:10087626-10087648 AGAAATACTGGCCTCTTCCCTGG + Intronic
950090630 3:10291835-10291857 TTCACCACAGGCCTCTTTCCTGG - Intronic
950918423 3:16668284-16668306 AGCAACACTTGCTTCTTCCCAGG - Intronic
951291469 3:20876337-20876359 AGCACTACAAGCCTTTTCCTAGG - Intergenic
954340224 3:49947384-49947406 TGCACCACTGGACTCTACCCTGG + Intronic
956493744 3:69802220-69802242 AGCACCCCTGGCCTATACCCAGG - Intronic
957058435 3:75462063-75462085 AGCTCCCCAGGCTCCTTCCCAGG - Intergenic
959117460 3:102195001-102195023 AGCAACACTGCCCTCTACCCTGG + Intronic
960613880 3:119579773-119579795 AGCAGCCAAGGCCTCTTCCCCGG + Exonic
961295014 3:125877639-125877661 AGCTCCCCAGGCTCCTTCCCAGG + Intergenic
961454580 3:127017697-127017719 AGGACGAGGGGCCTCTTCCCTGG - Intronic
961890889 3:130129525-130129547 AGCTCCCCAGGCTCCTTCCCAGG - Intergenic
962399005 3:135041081-135041103 ACCACCTGGGGCCTCTTCCCTGG + Intronic
964857625 3:161164108-161164130 CACACCACAGGCCTCTTCCCAGG + Intronic
966742998 3:183251320-183251342 AGTAACACAGGCCTCTTCCTTGG + Intronic
967941472 3:194769566-194769588 GGCAGGACAGTCCTCTTCCCGGG + Intergenic
969002279 4:3991943-3991965 AGCTCCCCAGGCTTCTTCCCAGG - Intergenic
969328012 4:6454965-6454987 TGCACCACACGGCTCCTCCCTGG + Intronic
969420075 4:7088899-7088921 GGCACCACAGACCCCTTTCCTGG - Intergenic
969751732 4:9116571-9116593 AGCTCCCCAGGCTTCTTCCCAGG + Intergenic
969811643 4:9652869-9652891 AGCTCCCCAGGCTCCTTCCCAGG + Intergenic
969841395 4:9885427-9885449 AGCCCCAGCTGCCTCTTCCCTGG + Intronic
972817188 4:42657158-42657180 AGCCCCGCAGGCCCCTCCCCCGG - Intergenic
975073955 4:70181246-70181268 AGCATCACTGTCCTCATCCCTGG + Intergenic
975842223 4:78487147-78487169 AGCAGCACAGGCCATTTCACTGG + Intronic
975849940 4:78561725-78561747 AGCAGAACAGGCATCTTTCCTGG + Intronic
976400280 4:84598941-84598963 AGCACCTCAGTTCTCTTTCCTGG + Intronic
976758571 4:88523915-88523937 CTCACCAGAGGCCTCTGCCCTGG - Intronic
977364322 4:96047904-96047926 AGCACCACTGCACTCTACCCTGG + Intergenic
980411293 4:132423054-132423076 AGCACCACAGCACTCCACCCTGG + Intergenic
980547862 4:134292799-134292821 AGGTCCACAGGCCTGTTACCAGG - Intergenic
982327283 4:154141360-154141382 AGCACCTCAAGCCTCTTCCCTGG - Intergenic
985866049 5:2515457-2515479 TGCACCACAGGCATCCTCGCAGG + Intergenic
986206568 5:5630212-5630234 AGCAACACAGAGCTCTTCGCAGG + Intergenic
987262868 5:16221375-16221397 GCCAGCACAGGCCTCCTCCCCGG + Intergenic
988662146 5:33282620-33282642 AGCACCACAGGCATATCCTCAGG - Intergenic
989262841 5:39437703-39437725 AGCAATACAGGCCTCTTTCTAGG - Intronic
990322642 5:54644977-54644999 AGCTTCTCAGGCCCCTTCCCAGG + Intergenic
994174806 5:96700039-96700061 GGCAACACAGCTCTCTTCCCAGG + Intronic
995470546 5:112497192-112497214 AGCACCACTGCCCTCTAGCCTGG + Intergenic
998280611 5:140803219-140803241 GGCACCCAAGGCCTCGTCCCAGG + Exonic
998481449 5:142466549-142466571 AGAACCTCATGTCTCTTCCCAGG - Intergenic
999738690 5:154532632-154532654 AGCACCAGAGGCAGTTTCCCAGG + Intergenic
1000998753 5:167985192-167985214 AGCACCACAGCCCCATTCCTGGG + Intronic
1001584385 5:172823509-172823531 ATTAACACAGGCCTCTTCCTTGG + Intergenic
1001604403 5:172949679-172949701 AGCATCCCTGGCCTCTACCCAGG - Intronic
1004425761 6:15505917-15505939 GGCAATAAAGGCCTCTTCCCAGG - Intronic
1006150305 6:31983493-31983515 ACCCCCACAGTCCTCTTCCCAGG + Intronic
1006156606 6:32016231-32016253 ACCCCCACAGTCCTCTTCCCAGG + Intronic
1006276053 6:33006506-33006528 AGCACCACATGCCTCACCCCTGG + Exonic
1006578926 6:35065464-35065486 AGCAGCAGAGGCGTCTTTCCTGG + Intronic
1007472524 6:42100013-42100035 AGCAACTCACGTCTCTTCCCGGG + Intergenic
1007574574 6:42916634-42916656 AGGACCCAAGGCCTCTTCCCAGG + Intronic
1015089119 6:129332934-129332956 AGCACCACTGCCCTCTAGCCTGG - Intronic
1015497069 6:133893193-133893215 AACCCCACAGGCCGCTTCGCGGG + Exonic
1015570961 6:134621061-134621083 AGCTCCAAATGCCACTTCCCAGG - Intergenic
1016792336 6:148079001-148079023 AGCCACACAGTCCTCTGCCCTGG - Intergenic
1017009381 6:150053010-150053032 AGCAGCACGAGCCTCTCCCCGGG + Intergenic
1018094660 6:160374700-160374722 AGCACCACAGGGCTCATCTCTGG + Intronic
1018095878 6:160386681-160386703 AGCAGCACAGACATCTTCCAAGG + Intronic
1018837249 6:167494261-167494283 ACCCCCTCAGGCCTCCTCCCAGG - Intergenic
1018892691 6:167994069-167994091 GTCACCACAGGGCACTTCCCCGG + Intergenic
1019305418 7:332360-332382 AGCACGCTTGGCCTCTTCCCAGG + Intergenic
1019629950 7:2043735-2043757 ACCACCCCAGGCCTCCTGCCAGG + Intronic
1020180202 7:5916385-5916407 TGCCCCACACGCCTCTTCCCCGG - Intronic
1020302730 7:6808497-6808519 TGCCCCACACGCCTCTTCCCCGG + Intronic
1020723676 7:11781400-11781422 AGCACCACTGTACTCTTGCCTGG + Intronic
1021456893 7:20839267-20839289 GGCACCAAAGTCCTCTTCCATGG - Intergenic
1022527942 7:31050386-31050408 AGCCCCACTGGCCCCTTCCAGGG + Intergenic
1024058496 7:45681712-45681734 ATTTGCACAGGCCTCTTCCCTGG - Intronic
1024474673 7:49798153-49798175 AGCACCATGGGCCTTTTGCCAGG - Intronic
1024574709 7:50754394-50754416 AACAGCACAGCCCACTTCCCTGG + Intronic
1024667920 7:51564524-51564546 AGCACCTCAGGCATCTGCACAGG - Intergenic
1024961371 7:54980656-54980678 AGCAACATAGGCCTATCCCCAGG + Intergenic
1025233631 7:57219210-57219232 AGCAGCACTGGCCCCTCCCCAGG - Intergenic
1025233877 7:57220582-57220604 AGCAGTACCGGCCTCTCCCCAGG - Intergenic
1026940666 7:74286182-74286204 AGCAGCCCAGGCCTCTCCCGTGG + Intergenic
1027913351 7:84281290-84281312 AGCACCACAGACCTCCTCTATGG - Intronic
1030351686 7:108496189-108496211 AGCACCACTGTACTCTACCCTGG + Intronic
1031161302 7:118171982-118172004 AGCTACCCAGGCCTTTTCCCCGG - Intergenic
1034093118 7:148382210-148382232 AGCCCCACAGGCCTGGGCCCGGG + Intronic
1035431042 7:158821984-158822006 ATCACCACAGCCCGCCTCCCAGG + Intronic
1036374937 8:8192001-8192023 AGCTCCCCAGGCTCCTTCCCAGG + Intergenic
1036854606 8:12231150-12231172 AGCTCCCCAGGCTCCTTCCCAGG - Intergenic
1036875965 8:12473643-12473665 AGCTCCCCAGGCTCCTTCCCAGG - Intergenic
1037758628 8:21727472-21727494 AGCCCCACAGACTTCTGCCCTGG - Intronic
1038970851 8:32633391-32633413 ACCTCCAAAGGCCTCTTGCCTGG + Intronic
1039213630 8:35243086-35243108 AGAACCTCAGGCCCCTCCCCAGG - Intronic
1039841663 8:41297879-41297901 AGCACCCGATGCCCCTTCCCAGG + Intronic
1040530132 8:48260336-48260358 AGCACCCCTCGCCTCTTCCAAGG - Intergenic
1041454130 8:58039382-58039404 AGCACCACAGGCCTGTTCCAGGG + Intronic
1042267715 8:66925679-66925701 CGCACCTTAGCCCTCTTCCCTGG + Intergenic
1047192295 8:122689115-122689137 AGCACCACTGCACTCTACCCTGG + Intergenic
1048293174 8:133195858-133195880 AGCAACCCAGGGATCTTCCCAGG + Intronic
1049070313 8:140350693-140350715 AGCCCCACATGCCTGTTCCTGGG - Intronic
1049395013 8:142395981-142396003 AGAGCCACAGGCGTCTGCCCTGG - Intronic
1049395020 8:142396022-142396044 AGAGCCACAGGCGTCTGCCCTGG - Intronic
1049407671 8:142458902-142458924 CGAACCACAGGCCACTTCTCTGG - Intronic
1049525957 8:143127152-143127174 GGCCCCACAGCACTCTTCCCTGG + Intergenic
1049540042 8:143204482-143204504 GCCACCACAGTCCACTTCCCCGG + Intergenic
1049683623 8:143930607-143930629 GGCCCCACAGGCCTGGTCCCGGG - Intronic
1051197326 9:14577025-14577047 GGCAGCACAGGCCTCTACTCAGG - Intergenic
1051997235 9:23232869-23232891 ACCACCACATGGCCCTTCCCAGG - Intergenic
1052654783 9:31343337-31343359 AGCACCATAGACATCTTCACTGG - Intergenic
1056291398 9:85147530-85147552 AGCCACACTGACCTCTTCCCTGG - Intergenic
1057212894 9:93210200-93210222 AGCACCACAGCCCACATCCCTGG - Intronic
1057522696 9:95772559-95772581 AGCTTCAGCGGCCTCTTCCCTGG - Intergenic
1060414300 9:123419851-123419873 AGCAGCACAGCCCTCATCCAGGG - Intronic
1060906816 9:127314367-127314389 TGAACCAGAGGCCCCTTCCCGGG - Intronic
1061628862 9:131858945-131858967 GGCACCTAAGGCCTCTGCCCAGG - Intergenic
1062051042 9:134447252-134447274 GCCACCGCAGGCCTGTTCCCTGG + Intergenic
1062105884 9:134754529-134754551 AGCGGACCAGGCCTCTTCCCTGG + Intronic
1062486246 9:136777775-136777797 AGCAGCACCAGCCTCTCCCCAGG + Intergenic
1062498366 9:136842100-136842122 TGCCCCACTGGCCTCTCCCCAGG - Intronic
1185445332 X:254887-254909 AGCACCCCAGGCCGCCTGCCTGG - Intergenic
1185461493 X:334703-334725 TGCACCGCAGGCCCCTCCCCCGG - Intronic
1186423669 X:9446029-9446051 AACAGCACACGCCTGTTCCCTGG - Intergenic
1190041617 X:47077000-47077022 TGCACCACAGCCCATTTCCCAGG + Intergenic
1195667790 X:107446268-107446290 ATCACCACAGCCCTCTTACCAGG - Intergenic
1196964843 X:121044215-121044237 AACACCAGAGCACTCTTCCCAGG - Intergenic
1198043679 X:132878842-132878864 AGCACCACAAAACGCTTCCCTGG + Intronic
1199359919 X:146906445-146906467 TGCACCACAAGCAGCTTCCCCGG + Intergenic