ID: 1149516881

View in Genome Browser
Species Human (GRCh38)
Location 17:57287621-57287643
Sequence GAAAGGCAGAGAAGCACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 291}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149516881_1149516884 -9 Left 1149516881 17:57287621-57287643 CCTGTGGTGCTTCTCTGCCTTTC 0: 1
1: 0
2: 1
3: 26
4: 291
Right 1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG 0: 1
1: 0
2: 0
3: 3
4: 29
1149516881_1149516887 -2 Left 1149516881 17:57287621-57287643 CCTGTGGTGCTTCTCTGCCTTTC 0: 1
1: 0
2: 1
3: 26
4: 291
Right 1149516887 17:57287642-57287664 TCGGCTCCTACGTGGGGCATTGG 0: 1
1: 0
2: 0
3: 4
4: 35
1149516881_1149516889 18 Left 1149516881 17:57287621-57287643 CCTGTGGTGCTTCTCTGCCTTTC 0: 1
1: 0
2: 1
3: 26
4: 291
Right 1149516889 17:57287662-57287684 TGGAAAGCCCTTTCCCTGCCTGG 0: 1
1: 1
2: 1
3: 42
4: 265
1149516881_1149516883 -10 Left 1149516881 17:57287621-57287643 CCTGTGGTGCTTCTCTGCCTTTC 0: 1
1: 0
2: 1
3: 26
4: 291
Right 1149516883 17:57287634-57287656 TCTGCCTTTCGGCTCCTACGTGG 0: 1
1: 0
2: 0
3: 10
4: 55
1149516881_1149516885 -8 Left 1149516881 17:57287621-57287643 CCTGTGGTGCTTCTCTGCCTTTC 0: 1
1: 0
2: 1
3: 26
4: 291
Right 1149516885 17:57287636-57287658 TGCCTTTCGGCTCCTACGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149516881 Original CRISPR GAAAGGCAGAGAAGCACCAC AGG (reversed) Intronic
900706656 1:4084996-4085018 GAAACTCACAGAAGCATCACTGG - Intergenic
901047466 1:6405984-6406006 GAAAGCAAGAGAAGCACTTCTGG - Intergenic
901188050 1:7387588-7387610 GAAAAGCAGAGAAGCACGAGAGG - Intronic
901712453 1:11126354-11126376 GCAAGGCAGAGAAGTAACAGTGG - Intronic
902910999 1:19597180-19597202 GGAAGGAAGGGAAGCCCCACGGG + Intronic
904681279 1:32231050-32231072 GAAAGGCAGAGACCCAACCCAGG - Intronic
904969523 1:34408200-34408222 GGAAGGCAGAGCAGCCTCACAGG - Intergenic
905456194 1:38089655-38089677 GACCGGCAGACAAGCACAACAGG - Intergenic
905661100 1:39726248-39726270 GAAGGGCAGAGAAACAGAACAGG - Intronic
906456319 1:46000349-46000371 TAAAGCCAGAGAACCTCCACTGG + Intronic
907438925 1:54466452-54466474 GATAGACAGAGAAGTACCAGTGG + Intergenic
908501415 1:64746202-64746224 GAAAGACAGAGAAGCACAAAGGG + Intronic
908736870 1:67285704-67285726 GGAGAGCAGAGAAGGACCACAGG - Intergenic
909665314 1:78125548-78125570 AAAAGGCACAGAAGCATCACAGG - Intronic
910440948 1:87251100-87251122 GAAAGGAAGAAAAGCAACAAGGG + Intergenic
911042708 1:93603729-93603751 GAGAGGCAGAGTAGCACGGCAGG - Intronic
911153498 1:94617951-94617973 CATAGGCAGAGTAGCAGCACGGG - Intergenic
911470326 1:98310177-98310199 GCAAGCCAGGGAAGCACCATGGG - Intergenic
914390266 1:147214898-147214920 TAAATGAAGAGAAGCACCACTGG + Intronic
914404303 1:147355685-147355707 GAAAGGCAGAGAAGGAGCATGGG - Intergenic
915079186 1:153339930-153339952 TAGAAGCAGAGAAGCAGCACGGG + Intronic
915496593 1:156286282-156286304 GAAGGGCAGAAAAGCATAACAGG - Exonic
915637295 1:157195707-157195729 GAAAGGCAGAGAAGGGGCACTGG + Intergenic
916311692 1:163405740-163405762 GAAAGGCAGAGAAACAAAAAAGG - Intergenic
916787952 1:168099751-168099773 TACAGGCAGAAAAGCCCCACAGG + Intronic
917606512 1:176636457-176636479 GAAAGTCAGAGGAGGAACACTGG + Intronic
918136151 1:181675620-181675642 GGAAGGCAGAGAAGCTCAAAAGG + Intronic
918411075 1:184258613-184258635 GAAAGGCAGAGAAGCAGTTTTGG + Intergenic
919272682 1:195370111-195370133 GGCAGGCAGAGAAACACCAAAGG + Intergenic
922364298 1:224849719-224849741 CATAGGCAGAGCAGCACCAAGGG - Intergenic
923121740 1:230998537-230998559 GAAAGGCAGTGAAGAAACAGGGG - Intronic
923865855 1:237938818-237938840 GAAATGCAGAGAGACTCCACAGG - Intergenic
1063512305 10:6657339-6657361 TAAAGTCAGAGAAAAACCACAGG + Intergenic
1063862383 10:10325205-10325227 GAAAGGAAGATAAACTCCACAGG + Intergenic
1063884881 10:10567474-10567496 GGAAGGCAGAGAAGCAGAATGGG + Intergenic
1066387312 10:34952148-34952170 CATAGGCAGAGCAGCACCAAGGG - Intergenic
1067050075 10:43010696-43010718 CCCAGGCAGAGAACCACCACAGG + Intergenic
1069426341 10:68291747-68291769 GAAAGGCACAAAAGAACCAATGG - Intronic
1070539893 10:77408568-77408590 GTAAGGGAGAGAAACCCCACTGG + Intronic
1073054177 10:100688513-100688535 GAAAGCCAGAGAGGCACATCAGG + Intergenic
1075292283 10:121240830-121240852 TAAAGGCAGATAAGCGCCAAGGG - Intergenic
1075923625 10:126233475-126233497 GAAAAGTAGAGAGGCACCGCAGG + Intronic
1076203031 10:128573118-128573140 GACAGGCAGGGCAGCAGCACCGG + Intergenic
1076557941 10:131341704-131341726 GAATGGCAGAGAGGAAGCACAGG + Intergenic
1077613998 11:3662052-3662074 GGGAGGCAGAGAAGGACCAAAGG - Intronic
1078653388 11:13216399-13216421 GGCAGGCAGGGAAGCAGCACTGG - Intergenic
1079080605 11:17411071-17411093 AAAAGGCAGAGCAGCACTCCAGG - Intronic
1081606511 11:44530469-44530491 CAAAGGCAGAGCAGCAGTACGGG + Intergenic
1081686862 11:45048986-45049008 GAAAGGGAGAGAGGCAGCAGTGG + Intergenic
1082797380 11:57387904-57387926 GGAAGGCAGAGAAGCAGACCTGG + Intronic
1083883626 11:65560122-65560144 GAAGGGCAGGGAAGCAGGACAGG + Intergenic
1084601405 11:70147880-70147902 GAAAAGCTGAGAAGCCACACGGG - Intronic
1084605599 11:70170005-70170027 CAAAGCCAGAGAAGCCCCAGAGG + Intronic
1086161078 11:83722796-83722818 GAAATGCAAAGAAGCATCAGGGG + Intronic
1088545446 11:110954422-110954444 CAAAGTCACAGAAGCACGACTGG + Intergenic
1088699767 11:112401221-112401243 GAAAGACAGAGAAGCTGCCCAGG - Intergenic
1090372516 11:126266577-126266599 GAAGGGCAAAAAAGCACCCCGGG - Exonic
1090595834 11:128320187-128320209 GGAAGGCAGTGAATCTCCACTGG + Intergenic
1090901590 11:131037152-131037174 GAAAGCCAGAGTAGAACCAATGG + Intergenic
1090936991 11:131351999-131352021 GAAATGCAGGGATGCACCATGGG - Intergenic
1091409035 12:227251-227273 GCAAGCCTGAGAAGCACCACAGG - Intronic
1091820708 12:3473397-3473419 GAGAGGCAGAGGAGAACCAGAGG - Intronic
1092094624 12:5831436-5831458 GGGATGCAGGGAAGCACCACAGG + Intronic
1092997210 12:13961776-13961798 GAATGGCAGACAAGAATCACTGG + Intronic
1093689582 12:22094747-22094769 GAAAAGCAGGGAAAGACCACAGG + Intronic
1094709493 12:32947110-32947132 CACAGGCAGAGCAGCCCCACGGG - Intergenic
1095563934 12:43598537-43598559 GGAAGACACAGAAGCACCAATGG + Intergenic
1096337084 12:50764514-50764536 GAAAGGAGGAGACGCACGACTGG - Intronic
1096924471 12:55127972-55127994 GAAAGTGAGAGAAGCAGAACTGG + Intergenic
1098399089 12:70054258-70054280 GAAGGGAAGAGAAGCTCTACAGG + Intergenic
1100021393 12:90073658-90073680 GAAAGGGAGAGAAGAAGCATGGG + Intergenic
1100939175 12:99706716-99706738 GAAAGGGAGAGAATCAACAGAGG - Intronic
1101557517 12:105824212-105824234 GAAACGAAGAGAAACACGACTGG + Intergenic
1101913018 12:108874837-108874859 GAGAGCCAGAGAAGGACCCCAGG - Intronic
1104466633 12:128995675-128995697 CATAGGCAGAGCAGCACCATGGG + Intergenic
1104717871 12:131028584-131028606 AACAAGCAGAGAAGGACCACAGG - Intronic
1106482748 13:30149084-30149106 GCCAGGCTGAGAATCACCACTGG - Intergenic
1107552768 13:41492770-41492792 GGAAGGCAGAGAAAAAACACTGG + Intergenic
1107898032 13:44985727-44985749 GAGAGGGAGAGGAGAACCACCGG - Intronic
1108926099 13:55747886-55747908 GAAAAGCAGAGAAGTTCAACTGG - Intergenic
1109493331 13:63132569-63132591 GACAGGAAGAGAAGCCTCACCGG + Intergenic
1110113687 13:71783625-71783647 GAAAGGCAGAGAAGAAGGAATGG + Intronic
1111811803 13:93100512-93100534 GAGACACAGAGAAGCACCAGGGG - Intergenic
1112407398 13:99133525-99133547 AAAAGGCAGAGGAGCACTTCTGG + Intergenic
1113432278 13:110261468-110261490 GGAAGCCACAGAAGCAGCACTGG - Intronic
1114971194 14:28030970-28030992 TAAAAGCAAAGAAGCAACACTGG + Intergenic
1118399413 14:65365788-65365810 CATAGGCAGAGCAGCACCAAGGG - Intergenic
1119916543 14:78407216-78407238 GAAAAGCAAAGAAGCATCATGGG + Intronic
1121317288 14:92969881-92969903 GAAAGGCAGAGAGGGAAGACGGG - Intronic
1123424058 15:20154751-20154773 GAAAGGCACAGAAGCAGGATAGG - Intergenic
1123533278 15:21161280-21161302 GAAAGGCACAGAAGCAGGATAGG - Intergenic
1124253669 15:28123707-28123729 GGCAGGCAGAGAAGGACCGCAGG + Intronic
1125277934 15:38013065-38013087 GGCAGACAGAGAACCACCACTGG + Intergenic
1128005259 15:64233478-64233500 AAGAGGCAGGGAAGGACCACAGG + Intronic
1129462998 15:75709360-75709382 GAAAGGCAGTGAAGGAGCAGAGG + Intronic
1130108668 15:80947685-80947707 GGGCGGCAGAGAAGCTCCACGGG + Intronic
1130123248 15:81070242-81070264 GAAAGGCAGGGAAGGACCAGGGG + Intronic
1130863222 15:87909397-87909419 CAGAGGCAGAGAAGCAGCACTGG + Intronic
1131601472 15:93853590-93853612 GAGAGACACAGAAGCCCCACAGG + Intergenic
1132850204 16:2021627-2021649 AAAAGGCAGAGAAGCAGGCCGGG - Intergenic
1134806009 16:17126044-17126066 GAAAGGCAAGGAAGAACTACAGG - Intronic
1136404365 16:30035418-30035440 GCAGGGCAGTGAAGCACAACGGG + Intronic
1136683326 16:31980369-31980391 GAAAGGCAGGGACAGACCACAGG + Intergenic
1136860811 16:33701135-33701157 GAAAGGCACAGAAGCAGGATAGG + Intergenic
1137446849 16:48537133-48537155 GAAAGGCAAAGCTGCACCAGAGG - Intergenic
1137745044 16:50814357-50814379 CAAAGGCAGAGCAGCATCATGGG - Intergenic
1138990165 16:62381134-62381156 GAAAGGCAGAGAATCGCTGCAGG + Intergenic
1139777584 16:69326138-69326160 GAAAGGTAGAGGAGCAGTACTGG - Exonic
1141215157 16:82016801-82016823 GAAAGGAAGTGGGGCACCACTGG + Intergenic
1141842951 16:86586096-86586118 GCAAAGCAAAGAAGCACCAAAGG - Intergenic
1142312689 16:89323334-89323356 GTATGGAAGAGAAGCACCACTGG + Intronic
1203122306 16_KI270728v1_random:1549318-1549340 GAAAGGCACAGAAGCAGGATAGG + Intergenic
1142675061 17:1508495-1508517 GAAAGGCTGAGAAGCCCTCCTGG + Intronic
1144031811 17:11329878-11329900 GAAAGAGAGAAAAGCATCACTGG - Intronic
1144762392 17:17714728-17714750 GAAGGGCACAGAAGCAGGACTGG + Intronic
1147144235 17:38476080-38476102 GAAAGGCAGGGACAGACCACAGG + Intronic
1148484933 17:47984546-47984568 AAAAGGCAGAGAAGAGCCACAGG - Intergenic
1148836647 17:50469120-50469142 GGTAGGCAGAGGAGCACCATAGG - Intronic
1149516881 17:57287621-57287643 GAAAGGCAGAGAAGCACCACAGG - Intronic
1150620977 17:66807535-66807557 GAAAGGAAGGGAAGCACTGCCGG - Exonic
1151460805 17:74252995-74253017 GAAAGGCAGGGAAGTAGGACAGG + Intronic
1153388789 18:4531935-4531957 GAAAGGCAAAGAAGAAGCAAAGG + Intergenic
1156526940 18:37776559-37776581 GAGAGGCAAAGAAACATCACTGG + Intergenic
1156839037 18:41589569-41589591 GAAAGGAAGAGAAGAAACAATGG - Intergenic
1156857493 18:41799265-41799287 GCAGAGCAGAGAAGCACCTCTGG - Intergenic
1157730852 18:50002897-50002919 AAAGAACAGAGAAGCACCACAGG + Intronic
1157741105 18:50093988-50094010 CGAAGGCAGAGAAGCCCCAAGGG - Intronic
1157901381 18:51521788-51521810 GAAATGCATAGGAGGACCACTGG - Intergenic
1158051487 18:53226098-53226120 GAAGGGCTGAGTAGCAGCACAGG + Intronic
1158831523 18:61284582-61284604 GAAAGAAAGAGAAGCAGCATAGG - Intergenic
1159396587 18:67865719-67865741 GAAAGTAAGGGAAGCACCAAAGG - Intergenic
1161274669 19:3409193-3409215 GAAAGGCAGAGACAGACCCCAGG - Intronic
1162182124 19:8877017-8877039 GAAAGGCAGAGAAGGATCGATGG - Intronic
1164821663 19:31255694-31255716 GACAGGCAGAGCAGCAGCAGAGG + Intergenic
1165335224 19:35165224-35165246 TATAGGCAGAGCAGCCCCACAGG + Intronic
1168004407 19:53474971-53474993 GAAAGGCAGAGAGGCAAAGCAGG - Intronic
925461262 2:4064908-4064930 GAAAAGGAGATAAACACCACTGG - Intergenic
925721782 2:6836451-6836473 GAAAGGCAGAAAAGGACTATGGG + Intergenic
926299625 2:11593185-11593207 GAAAGGGAGAGAACCACCAAAGG - Intronic
926939288 2:18118179-18118201 GAAAGGCAGAGGAGGAGCAAAGG + Intronic
927466484 2:23340551-23340573 GGAAGGAAGAGAAGAAGCACAGG + Intergenic
927608299 2:24509549-24509571 GAAAGTCAGAAAATGACCACAGG - Intronic
927962875 2:27251504-27251526 TAAAGGCAGAGCAGAACCAGAGG + Intergenic
929262817 2:39885063-39885085 GAAAGGCAGAGAAAGGACACAGG + Intergenic
929970056 2:46566372-46566394 GTAGGGTAGAGAAGCACCATAGG - Intronic
930625881 2:53697370-53697392 CATAGGCAGAGCAGCAGCACAGG - Intronic
931201041 2:60097534-60097556 CCAAGGCAGAGAAGCAACTCTGG - Intergenic
934459190 2:94202291-94202313 GAAAGGCACAGAAGCAGGATAGG + Intergenic
935729524 2:106053875-106053897 GATAGGAAGAGGAGCACCAGCGG + Intergenic
938392227 2:130915403-130915425 GAGAGACACAGAAGCACCTCTGG + Intronic
940238915 2:151541985-151542007 GAGAGGCAAAGAAGAAACACAGG - Intronic
940799154 2:158114301-158114323 GAGGAGCAGAGAAGCACTACGGG - Intronic
942246509 2:174013230-174013252 GAGAGGGAGAGAAGCAGGACGGG - Intergenic
942611435 2:177745965-177745987 GAAAGGCATTGAGGCCCCACAGG - Intronic
944968333 2:204961801-204961823 TAAAGCCAGAGAAGCACCTTTGG + Intronic
945194355 2:207224396-207224418 CAAATGCAGAGATGCAGCACTGG + Intergenic
946037054 2:216752583-216752605 GGAAGGCAGAGCAGCATCTCTGG + Intergenic
948363278 2:237437597-237437619 GAGGGTCAGAGAAGCAGCACTGG + Intergenic
948502166 2:238403555-238403577 GCAAGGCAGACAGGGACCACGGG - Intergenic
948946376 2:241222363-241222385 GACAAGCAGAGAAGCACTGCTGG - Intronic
1169386482 20:5154345-5154367 GAGAGGCAGAGAACTACCAAGGG - Intronic
1170061824 20:12266882-12266904 GAAAGGAAGAAAAGCAGTACTGG + Intergenic
1170109705 20:12791602-12791624 GAAAGGCAGGGAAGCATCTGAGG + Intergenic
1170775382 20:19370902-19370924 TAAAGGATGAGAACCACCACCGG - Intronic
1172919047 20:38466072-38466094 GAGAGGCAGAGAAACAGGACGGG + Intergenic
1173813291 20:45969424-45969446 GTCAGGCAGAGGAGCCCCACAGG - Intronic
1174048281 20:47749159-47749181 GAAAGGCAGAGAAGGAGCTTGGG + Intronic
1174076510 20:47941356-47941378 GGAGGACACAGAAGCACCACGGG - Intergenic
1174474179 20:50784172-50784194 AAAAGCCACAGAAGCACCACCGG - Intergenic
1174547763 20:51338646-51338668 CATAGGCAGAGCAGCAGCACGGG + Intergenic
1175621058 20:60447988-60448010 GACAGGCATAAAACCACCACTGG - Intergenic
1175735838 20:61386428-61386450 GGAAGGCAGAGTGGAACCACTGG - Intronic
1177529689 21:22343185-22343207 CATAGGCAGAGAAGCAGCATGGG + Intergenic
1178082049 21:29076198-29076220 GAAAGGCAAATAAGCTCCCCTGG - Intergenic
1180258870 21:46652464-46652486 GAAAGGCAGAGAAATGCCAGAGG + Intronic
1181025470 22:20124961-20124983 GAAATGCAGAGAAGCAGAGCTGG - Intronic
1181357019 22:22304198-22304220 GAAAGGCACAGAAGCAGGATAGG - Intergenic
1182367411 22:29788455-29788477 GCAAGGCAGAGCAGCATCAGAGG + Intergenic
1183354900 22:37352988-37353010 GAAAGGCAGAGAAGTGGCTCTGG + Intergenic
1184402631 22:44282623-44282645 GAAAGGCAGAGAAGCCACAGAGG + Intronic
950092100 3:10303212-10303234 GCAAGGGAGAGAAGCAGCAAGGG + Intronic
950267953 3:11589061-11589083 GAAAGCCAGAAAAGGGCCACAGG + Intronic
950362158 3:12457144-12457166 GAAAGACACAGAAGAACCACAGG - Intergenic
952233469 3:31455434-31455456 GAAAGAGAGGAAAGCACCACGGG + Intergenic
953268508 3:41416714-41416736 GAAAGACAGAGCTGCAACACAGG + Intronic
953712372 3:45285262-45285284 GAATGGAAGAGAAGCTCCAGGGG + Intergenic
954901013 3:54019920-54019942 GAATGACAGAAAATCACCACTGG - Intergenic
955879707 3:63530341-63530363 CAAAGGCTGGGAAGCACCATGGG - Intronic
955966790 3:64397108-64397130 GAAGGACAGAGAAAAACCACAGG + Intronic
956744943 3:72303989-72304011 GACAGGCAGGGAAGCAGCTCAGG + Intergenic
956952345 3:74297023-74297045 GAAAGGCAAAGAAACAGAACGGG + Intronic
957404782 3:79763572-79763594 GAAAGGCAGAAAAGAACAACTGG + Intronic
960005313 3:112775533-112775555 AAAAGGCAGAGAACCACGAAGGG + Intronic
960260069 3:115557294-115557316 GAAAGTCAAAGAAGTACCAAGGG + Intergenic
961316098 3:126036595-126036617 AAGAGGCAGCGAAGCACCCCAGG - Intronic
962260940 3:133905494-133905516 CAAAGGCAGAGTAGCAGCTCAGG + Intergenic
962536320 3:136332420-136332442 GGAAGGCAAAGAAGCACCCATGG - Intronic
964627467 3:158772976-158772998 GGAAGAGAGAGAAGCACCGCAGG - Intronic
965790254 3:172379650-172379672 GAAAGGCAAAGCTGCACCAAAGG - Intronic
967386492 3:188916714-188916736 GAAAAGCAAACAAGCAACACTGG + Intergenic
969606255 4:8203751-8203773 GAAGGGCAGAGAGGCACCCCTGG - Intronic
971164197 4:24165791-24165813 GAGAGGGAGAGGAGAACCACTGG - Intergenic
972656409 4:41067686-41067708 GAATGGTAGAGAGGTACCACGGG + Intronic
972891214 4:43558160-43558182 GAAAGCTGAAGAAGCACCACAGG + Intergenic
973851709 4:54967333-54967355 CAAAGAGAGAGAAGCAACACTGG - Intergenic
974109604 4:57511238-57511260 CCAAGGCAGAGAACAACCACTGG - Intergenic
980414912 4:132474091-132474113 AAAAAGCAAAGAAGCACCACAGG + Intergenic
981822192 4:148899153-148899175 GGAAGGCAGAGAAGGAGCAAAGG + Intergenic
981959272 4:150515853-150515875 GAAAGGCAGAGAGGGACCATGGG + Intronic
981998605 4:151001664-151001686 TAAAGGCAGAGATGACCCACTGG - Intronic
982749806 4:159146719-159146741 AATAGGCAGTGAAGCATCACAGG - Intronic
986576014 5:9213796-9213818 GAAAGGCAAGGAAGAACCAGAGG + Intronic
987888553 5:23844693-23844715 GAGAGGCAGACAAGGAACACTGG - Intergenic
988782216 5:34532724-34532746 GAAAGGCACAGAAGTACAAATGG - Intergenic
990063541 5:51682760-51682782 GAAAGGCAGAGAATTACAAGTGG - Intergenic
990598257 5:57332320-57332342 GACAAGCAGAGAAGTAGCACAGG - Intergenic
990772642 5:59266669-59266691 GAAAGGCAGACAAATACCATAGG + Intronic
990942639 5:61218728-61218750 GAAAAGGAGAGAAGCACATCGGG - Intergenic
991035991 5:62128022-62128044 AAAATGCAGAGATTCACCACAGG + Intergenic
992125832 5:73640175-73640197 GAAAAGCAGAGAAGAATCAAAGG - Intronic
992204255 5:74414816-74414838 GAAGGGCAGAGAAGGAAAACTGG - Intergenic
992266009 5:75018867-75018889 CAGGGGAAGAGAAGCACCACAGG + Intergenic
994156052 5:96505598-96505620 GAAAGGCATAGAATCACCACTGG + Intergenic
994624403 5:102200206-102200228 GAATGGTAGTGAAGCACCATGGG - Intergenic
994760347 5:103844152-103844174 GGAAGGCAAAGAAGCAGCAAAGG + Intergenic
995397927 5:111708048-111708070 GAAAGCTAGAGAGGCACCCCAGG - Intronic
996007732 5:118443414-118443436 AAGCGGCTGAGAAGCACCACAGG - Intergenic
999243240 5:150139430-150139452 GAAAGGCAGAGCTTCACCATAGG - Intronic
999878381 5:155834018-155834040 AAAAGGCAGAGAAACAGCAAGGG - Intergenic
1000765415 5:165283299-165283321 GAAGGGCAGGGAAGCAAGACTGG - Intergenic
1001696373 5:173673375-173673397 GAAATGCAGAGAGGCAGCCCTGG + Intergenic
1001741004 5:174052625-174052647 CAAAGGCAGCAAAGCACCAAAGG - Intronic
1001964707 5:175902043-175902065 GAAAGGGCGAGAAGCAGGACTGG - Intergenic
1001998166 5:176178703-176178725 GATACACACAGAAGCACCACAGG - Intergenic
1001998471 5:176181119-176181141 GATAGTCACAGCAGCACCACTGG - Intergenic
1002106601 5:176882314-176882336 GAAAGGCAGTGAAGGTCCCCAGG - Intronic
1004317412 6:14601774-14601796 GAGAGGCAGACCAGCACCCCAGG + Intergenic
1004467064 6:15895778-15895800 CATAGGCAGAGCAGCAGCACTGG + Intergenic
1004499603 6:16198061-16198083 GACCGGCAGAGCAGCTCCACCGG - Intergenic
1004602393 6:17162889-17162911 GAAAGAGAGAGAAGCATCAAGGG + Intergenic
1005946657 6:30600828-30600850 CAAAGGCAGACCAGCACCACCGG + Exonic
1005969272 6:30748776-30748798 GAGAGAGAGAGAAGCACCAAAGG + Intergenic
1007464280 6:42041163-42041185 GAAAGGCAGAGAAGAAACAGGGG + Intronic
1007498594 6:42279079-42279101 GGAAGGCAGAGAAGAACAACTGG + Intronic
1007585343 6:42985626-42985648 GAAAGGCAGAAATCCAGCACTGG - Intronic
1008005762 6:46407164-46407186 AAAAGAGGGAGAAGCACCACAGG + Intronic
1008142558 6:47848603-47848625 GAAAGGCAGAGTATCAGGACTGG - Intergenic
1009158024 6:60247566-60247588 CATAGGCAGAGTAGCCCCACAGG + Intergenic
1012197143 6:96357613-96357635 TAAAGGCAGAAAAGAACTACAGG + Intergenic
1014913436 6:127119164-127119186 GAAAGGAAGGGAAGCATTACTGG + Exonic
1015510502 6:134033720-134033742 GAAAGGAAGAGGAGAAGCACAGG - Intronic
1015720514 6:136236363-136236385 GGAAGGCAGAGAATCTGCACGGG + Intronic
1015772974 6:136787708-136787730 TACAGGCAAAGAAACACCACTGG + Intronic
1015891243 6:137971759-137971781 GAAAGGGATAGAAGAACCAATGG + Intergenic
1018495945 6:164345904-164345926 CATAGGCAGAGCAGCAGCACGGG + Intergenic
1018529725 6:164749949-164749971 AGAAGGCAGAAAAGCACCACTGG + Intergenic
1020059889 7:5144153-5144175 GATGGGCAGAGAAGCTCCAGGGG + Intergenic
1020168077 7:5823598-5823620 GATGGGCAGAGAAGCTCCAGGGG - Intergenic
1021032199 7:15751317-15751339 GAAAGGAAGAAAAGCCCCATGGG + Intergenic
1021792204 7:24217080-24217102 GAAAGGCAGAGAAGGACTTGAGG + Intergenic
1022885114 7:34635099-34635121 GATAAGCAGTGAAGAACCACTGG + Intergenic
1026301242 7:69100023-69100045 GAAACACAGAAAAGCACCAAAGG + Intergenic
1031068438 7:117134474-117134496 GAGAGGCAGAGTAGCACTACTGG - Intronic
1032910471 7:136423113-136423135 GAAAGGCAAAGAAACAGGACAGG - Intergenic
1033087958 7:138359524-138359546 CATAGGCAGAGCAGCAGCACAGG - Intergenic
1033180233 7:139170047-139170069 GAAATTCAAAGAATCACCACGGG + Intronic
1033306079 7:140226693-140226715 CATAGGCACAGCAGCACCACAGG - Intergenic
1035361803 7:158318321-158318343 GAAAAGCAGAGTAGGAACACTGG - Intronic
1035786358 8:2264299-2264321 GGAAGTCTGAGAAGCTCCACTGG + Intergenic
1035806449 8:2457417-2457439 GGAAGTCTGAGAAGCTCCACTGG - Intergenic
1040923831 8:52654379-52654401 GGAAGGCAGAAAAGCAGCACAGG + Intronic
1041271994 8:56117896-56117918 GAAACGCACAAAAGCACCAGCGG - Intergenic
1041437734 8:57861029-57861051 GAAATGCAGAGAAGCTCAAGGGG + Intergenic
1042178615 8:66062052-66062074 GAGAGGCAGAAAAGCAGCAAGGG - Intronic
1043030261 8:75125507-75125529 GAAAGGCAGAGGAGGAACAATGG + Intergenic
1043050715 8:75381994-75382016 GAAAGGATGAGAAGCTCAACTGG + Intergenic
1043256101 8:78138557-78138579 GAGAAGCAGAAAAGCACCATGGG + Intergenic
1043286857 8:78542967-78542989 GAAATGAAGAGAACCAACACAGG + Intronic
1044564019 8:93643758-93643780 GAGAGACAGAGAAGGAACACAGG - Intergenic
1048236698 8:132698009-132698031 GATAGGCAGGGAAGCACAAGTGG + Intronic
1048379573 8:133853380-133853402 GAAAAGCAGAGCAGATCCACAGG - Intergenic
1049956058 9:694291-694313 GAAAAGCAGAAAAGGAGCACTGG - Intronic
1051803568 9:20964860-20964882 GGAGGGGAGAGAAGCATCACTGG + Intronic
1052069232 9:24061070-24061092 TATAGGAAGAGAAGAACCACAGG + Intergenic
1052390643 9:27875354-27875376 CAAAGGCAGTGAAGAGCCACTGG + Intergenic
1053689686 9:40578078-40578100 GAAAGGCACAGAAGCAGGATAGG + Intergenic
1054300933 9:63379017-63379039 GAAAGGCACAGAAGCAGGATAGG + Intergenic
1055764359 9:79645577-79645599 AAAGGGCAGAAAAGGACCACTGG - Intronic
1056235098 9:84586515-84586537 GAAAGGCTGAGAAGCCAAACAGG - Intergenic
1057092904 9:92276298-92276320 GAAAGGCAGGGAAGCAGGAAAGG + Intronic
1057435184 9:95033405-95033427 GAATGGTAGAGAAACACAACAGG - Intronic
1057500734 9:95595075-95595097 GAAAGGCTGAGGAGCACTGCAGG + Intergenic
1057790228 9:98119516-98119538 GAAAGTGAGAGGAGCACCCCCGG - Intergenic
1057829144 9:98393671-98393693 GAGAGGCAGAGAAGAAAGACTGG + Intronic
1058966158 9:110040712-110040734 GAAAAGAAGTTAAGCACCACTGG + Intronic
1059241254 9:112807798-112807820 GAAGGAAAGAGAAGCAGCACAGG - Intronic
1060001591 9:119963767-119963789 GAGAAGCAGACAAGCATCACAGG + Intergenic
1186015796 X:5191872-5191894 GAAAGAAAGAGAAGCATCTCTGG - Intergenic
1187558387 X:20374917-20374939 GAAAGGCAGGGAAGCAACTCTGG - Intergenic
1189146874 X:38664580-38664602 GAAAGGCAGTCAACCTCCACGGG + Intronic
1189594699 X:42551776-42551798 GAATGTCTGAGAAGCACCCCTGG + Intergenic
1189998454 X:46661764-46661786 GAAAGGGAGAGAAACAGCAAAGG + Intronic
1190446290 X:50528122-50528144 GAAACACAGAGAAGGACCATGGG - Intergenic
1190565832 X:51729607-51729629 CAAAGGCAGAGCAGCCCCAAGGG + Intergenic
1190711705 X:53076412-53076434 GACAGGCAGAAAAACACAACAGG - Intronic
1191183734 X:57588300-57588322 GGATGGCAGAGAAGTTCCACTGG - Intergenic
1191213641 X:57914112-57914134 GGATGGCAGAGAAGTTCCACTGG + Intergenic
1192289363 X:69776487-69776509 GAAAGGCAGAGGAGGAGCAAAGG - Intronic
1192315713 X:70049854-70049876 GCAAGGCACTGAAGGACCACTGG + Exonic
1192579758 X:72271226-72271248 GAATGGCAGAGAAGCCCTATGGG + Intronic
1193262125 X:79420364-79420386 GGAAGGAGGAGAAGCATCACTGG - Intergenic
1194920018 X:99753514-99753536 GGAAGAAAGAGAAGTACCACAGG - Intergenic
1197379395 X:125721438-125721460 GAAAGGCAGAGGAGGAGCAAAGG + Intergenic
1197703476 X:129617010-129617032 GAAAGGCATAGAGGAACCATTGG + Intergenic
1197871244 X:131064723-131064745 GGAGGGCAGAGAAAGACCACAGG - Intronic
1197992732 X:132335279-132335301 GAAAGGCAGAAAAGGAAGACTGG + Intergenic
1198229898 X:134678885-134678907 AAAAGACAGAGGAGAACCACAGG + Intronic
1200427791 Y:3040513-3040535 GAAAGAAAGAGAAGCAGAACTGG + Intergenic
1201611503 Y:15848253-15848275 CAAAGGCAGAGAAGCATTCCTGG - Intergenic