ID: 1149516881

View in Genome Browser
Species Human (GRCh38)
Location 17:57287621-57287643
Sequence GAAAGGCAGAGAAGCACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 291}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149516881_1149516889 18 Left 1149516881 17:57287621-57287643 CCTGTGGTGCTTCTCTGCCTTTC 0: 1
1: 0
2: 1
3: 26
4: 291
Right 1149516889 17:57287662-57287684 TGGAAAGCCCTTTCCCTGCCTGG 0: 1
1: 1
2: 1
3: 42
4: 265
1149516881_1149516884 -9 Left 1149516881 17:57287621-57287643 CCTGTGGTGCTTCTCTGCCTTTC 0: 1
1: 0
2: 1
3: 26
4: 291
Right 1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG 0: 1
1: 0
2: 0
3: 3
4: 29
1149516881_1149516883 -10 Left 1149516881 17:57287621-57287643 CCTGTGGTGCTTCTCTGCCTTTC 0: 1
1: 0
2: 1
3: 26
4: 291
Right 1149516883 17:57287634-57287656 TCTGCCTTTCGGCTCCTACGTGG 0: 1
1: 0
2: 0
3: 10
4: 55
1149516881_1149516887 -2 Left 1149516881 17:57287621-57287643 CCTGTGGTGCTTCTCTGCCTTTC 0: 1
1: 0
2: 1
3: 26
4: 291
Right 1149516887 17:57287642-57287664 TCGGCTCCTACGTGGGGCATTGG 0: 1
1: 0
2: 0
3: 4
4: 35
1149516881_1149516885 -8 Left 1149516881 17:57287621-57287643 CCTGTGGTGCTTCTCTGCCTTTC 0: 1
1: 0
2: 1
3: 26
4: 291
Right 1149516885 17:57287636-57287658 TGCCTTTCGGCTCCTACGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149516881 Original CRISPR GAAAGGCAGAGAAGCACCAC AGG (reversed) Intronic