ID: 1149516884

View in Genome Browser
Species Human (GRCh38)
Location 17:57287635-57287657
Sequence CTGCCTTTCGGCTCCTACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 29}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149516881_1149516884 -9 Left 1149516881 17:57287621-57287643 CCTGTGGTGCTTCTCTGCCTTTC 0: 1
1: 0
2: 1
3: 26
4: 291
Right 1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG 0: 1
1: 0
2: 0
3: 3
4: 29
1149516880_1149516884 3 Left 1149516880 17:57287609-57287631 CCAGGGAAGAGGCCTGTGGTGCT 0: 1
1: 0
2: 4
3: 29
4: 329
Right 1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG 0: 1
1: 0
2: 0
3: 3
4: 29
1149516879_1149516884 4 Left 1149516879 17:57287608-57287630 CCCAGGGAAGAGGCCTGTGGTGC 0: 1
1: 0
2: 3
3: 44
4: 580
Right 1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG 0: 1
1: 0
2: 0
3: 3
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149516884 Original CRISPR CTGCCTTTCGGCTCCTACGT GGG Intronic