ID: 1149516884

View in Genome Browser
Species Human (GRCh38)
Location 17:57287635-57287657
Sequence CTGCCTTTCGGCTCCTACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 29}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149516880_1149516884 3 Left 1149516880 17:57287609-57287631 CCAGGGAAGAGGCCTGTGGTGCT 0: 1
1: 0
2: 4
3: 29
4: 329
Right 1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG 0: 1
1: 0
2: 0
3: 3
4: 29
1149516881_1149516884 -9 Left 1149516881 17:57287621-57287643 CCTGTGGTGCTTCTCTGCCTTTC 0: 1
1: 0
2: 1
3: 26
4: 291
Right 1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG 0: 1
1: 0
2: 0
3: 3
4: 29
1149516879_1149516884 4 Left 1149516879 17:57287608-57287630 CCCAGGGAAGAGGCCTGTGGTGC 0: 1
1: 0
2: 3
3: 44
4: 580
Right 1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG 0: 1
1: 0
2: 0
3: 3
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149516884 Original CRISPR CTGCCTTTCGGCTCCTACGT GGG Intronic
908918286 1:69158238-69158260 CTGCCTTTCTTCTCCTTCCTAGG + Intergenic
915616316 1:157042270-157042292 CTGTCTTGGGGCTCCTACCTTGG - Intronic
1071784781 10:88886983-88887005 CTGCCTTTGGGCTCATGCTTCGG + Intronic
1086766894 11:90706729-90706751 CTGCCTTCCTGCTACTACTTTGG + Intergenic
1093865375 12:24220881-24220903 CAGACTTTCGGCTACTACATAGG - Intergenic
1114637353 14:24195398-24195420 CTGCCTTTGGGCTCCTGCTGGGG + Intronic
1115463329 14:33686157-33686179 CTACCTTTTGGCTCTTAGGTTGG - Intronic
1126678732 15:51184130-51184152 CTGAGTTTCGGCCCCGACGTTGG + Intergenic
1141728111 16:85803826-85803848 CTGCATTTGGGCTCCTAGGTCGG + Intronic
1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG + Intronic
1163546972 19:17946504-17946526 CTGCCTGTCTCCTCCCACGTGGG - Intergenic
927250755 2:20993127-20993149 CTCCCTTTCCCCTCCTATGTAGG - Intergenic
927672001 2:25076300-25076322 CTGCCTTTTTTCTCCTAAGTTGG + Intronic
927702227 2:25275905-25275927 CTGCCTTCCTGCTCCTCCTTTGG - Intronic
935124652 2:100212849-100212871 TTGCATTTCAGATCCTACGTGGG - Intergenic
1179917311 21:44485775-44485797 CTCCCTTGTGGCTCCTCCGTCGG + Intergenic
1184245660 22:43234668-43234690 CTGCCCTTCCGCTCCTTCCTGGG + Intronic
953796821 3:45992304-45992326 CTGCCTCTCTGCACCTACGCTGG - Intronic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
954912857 3:54122964-54122986 CTGCCTTTCGGGACCCGCGTCGG + Intronic
957415356 3:79895207-79895229 CTGCCTTTGGGCTGCTACTCTGG + Intergenic
965783807 3:172315603-172315625 CTGCCTTTCTGCTCCTAATGGGG - Intronic
999366963 5:151029520-151029542 CTGCTTTTTGGCTCCTACCTTGG + Intergenic
1003652699 6:7975988-7976010 CTGCCTCTCAGCACCTGCGTGGG + Intronic
1005198298 6:23314386-23314408 CTTCCTTTCTGCTCCTGCATGGG + Intergenic
1006974221 6:38082374-38082396 CTGCCTTTCTGTTTCTAGGTGGG + Exonic
1007566100 6:42851713-42851735 CTGACTATCAGCTCCTATGTGGG - Intronic
1009658896 6:66583918-66583940 CTGCCTTTTGTCTCCTATATTGG - Intergenic
1016239158 6:141908313-141908335 CTGCCTTTCAGCTGCTACTCTGG - Intergenic
1032460801 7:132108889-132108911 TGGCATTTCGGCTCCTAGGTAGG + Intergenic
1034266349 7:149782925-149782947 CTGCCTTTCTGCTGCTGCGCTGG + Intergenic
1035317281 7:158004050-158004072 CTGCTTTTCGGCTCCTCGTTTGG + Intronic
1044744303 8:95357378-95357400 CTGCCTTTCGGCTCCTTCTGGGG + Intergenic