ID: 1149518966

View in Genome Browser
Species Human (GRCh38)
Location 17:57303958-57303980
Sequence CTGAATTACTAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 8, 3: 111, 4: 366}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149518955_1149518966 8 Left 1149518955 17:57303927-57303949 CCTTGAGAGAGTCCCTCAAGCAT 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG 0: 1
1: 0
2: 8
3: 111
4: 366
1149518960_1149518966 -5 Left 1149518960 17:57303940-57303962 CCTCAAGCATGGGAGGACCTGAA 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG 0: 1
1: 0
2: 8
3: 111
4: 366
1149518959_1149518966 -4 Left 1149518959 17:57303939-57303961 CCCTCAAGCATGGGAGGACCTGA 0: 1
1: 0
2: 4
3: 75
4: 357
Right 1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG 0: 1
1: 0
2: 8
3: 111
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149518966 Original CRISPR CTGAATTACTAGAGGGAGGA GGG Intronic
903054775 1:20628030-20628052 CTGAATTTCAAAAGGAAGGAAGG - Intergenic
903519215 1:23934758-23934780 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
905226883 1:36484755-36484777 CTGCATGACTAGGGAGAGGAGGG - Intergenic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
907684224 1:56594303-56594325 CTGAATAACTAGAAGGATGGAGG + Intronic
907905248 1:58778561-58778583 CTGCATTAGTGGAGGCAGGAAGG + Intergenic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
910195981 1:84640112-84640134 CTGAATTCCAAGAGGAAGGAGGG + Intergenic
911184230 1:94887330-94887352 CTGAATGAATAGGGGGAGGAGGG - Intronic
911516431 1:98873593-98873615 CTGAATTCCAAAAGGGAGGTGGG - Intergenic
912763626 1:112389689-112389711 CAGAATTACTGGAGGGAGACAGG + Intergenic
912938619 1:114025190-114025212 CTGAATTCCAAAAGAGAGGAGGG - Intergenic
913405790 1:118489329-118489351 CTGAATTACTAGAGAGAGTGAGG + Intergenic
914886186 1:151586297-151586319 CTGGAATCCTAGTGGGAGGAAGG - Intergenic
915045451 1:153010149-153010171 AAGAATGACTAAAGGGAGGAAGG - Intergenic
916801352 1:168219589-168219611 CTGAATTCCAAAAGGCAGGAGGG + Intergenic
917097995 1:171418804-171418826 CTGAACTCCAAAAGGGAGGAGGG + Intergenic
917530767 1:175833060-175833082 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
917710590 1:177680288-177680310 CTGAATTTGTAGAGGGAGTCTGG - Intergenic
917730314 1:177868580-177868602 GGGGACTACTAGAGGGAGGAGGG - Intergenic
918187754 1:182142989-182143011 CTGAATTCCTAAGGGGAGGAAGG + Intergenic
918823459 1:189290017-189290039 GTAGACTACTAGAGGGAGGATGG - Intergenic
919459412 1:197858412-197858434 GGGGACTACTAGAGGGAGGAGGG - Intergenic
919596555 1:199570838-199570860 CTGAATCCCAAAAGGGAGGAGGG - Intergenic
922035969 1:221848474-221848496 CTGAATTACAAGAAGGAAGACGG + Intergenic
922077516 1:222262446-222262468 CTGAATAACTGGTGTGAGGAAGG + Intergenic
922318974 1:224467943-224467965 ATGATTTAATAGAGGAAGGACGG - Intronic
922337385 1:224628784-224628806 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1064606150 10:17041767-17041789 ATGACTAACTAGAGGGAGAACGG - Intronic
1064641755 10:17422336-17422358 CTTAATTACTTGTGGGAGGGGGG - Intronic
1064939088 10:20712916-20712938 CTGAATTCCAAAAGAGAGGAGGG + Intergenic
1065012510 10:21432371-21432393 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1065096478 10:22285969-22285991 TTGAATTACAAATGGGAGGAGGG + Intergenic
1065602143 10:27379907-27379929 CTGGACTACTAGAGGGTGGAGGG - Intergenic
1065838848 10:29683448-29683470 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1066680155 10:37930317-37930339 ATGAATTACTGTAGGGTGGAAGG + Intergenic
1067154579 10:43767126-43767148 GTGGACTACTAGAGGGAGGAAGG + Intergenic
1067695911 10:48535560-48535582 CTGTCTTACTGCAGGGAGGATGG + Intronic
1067830108 10:49606870-49606892 TTGAATGAGTAGAGGAAGGAAGG - Intergenic
1068336329 10:55636726-55636748 CGGAATTACTAGGGGAAAGATGG - Intergenic
1068825852 10:61438082-61438104 TTCAATTCCTAGAGAGAGGAAGG + Intronic
1069543218 10:69311220-69311242 CTGAATTCCAAAAGGGATGAAGG + Intronic
1070171816 10:73938631-73938653 CTGAATTCCAAAAGGCAGGAGGG - Intergenic
1070393978 10:75995751-75995773 CTAAATTACTGCAGGCAGGAAGG - Intronic
1070430813 10:76335891-76335913 CTGAATTCCAACAGGGAGGAGGG + Intronic
1071959463 10:90796080-90796102 CTGAATTCCAAAAGGGAGGAAGG + Intronic
1072588145 10:96800537-96800559 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1072608387 10:97001579-97001601 CTGAACTGCTGGAGGGAGGGGGG + Intronic
1073204280 10:101760633-101760655 TTGAATTACTGGAGAGAGCAGGG - Intergenic
1073236855 10:102024119-102024141 CTGTATTTCTAGTGGAAGGAGGG - Intronic
1073360491 10:102894584-102894606 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1073439267 10:103543152-103543174 CTGCAGGACTACAGGGAGGAGGG - Intronic
1073843443 10:107525034-107525056 GGAAACTACTAGAGGGAGGAGGG + Intergenic
1074491669 10:113944437-113944459 CTGAATTACTAGGTTCAGGATGG - Intergenic
1075053267 10:119199035-119199057 CTGCATCACAGGAGGGAGGAAGG - Intergenic
1075271872 10:121059462-121059484 CTGAATTACAAGATGGAGGAGGG + Intergenic
1075592454 10:123702778-123702800 CTGAGGCACTAGAGGAAGGATGG + Intergenic
1076270844 10:129150748-129150770 CTGAAATCCAAAAGGGAGGAGGG - Intergenic
1076908484 10:133375281-133375303 CTACATTACTTGATGGAGGACGG - Intergenic
1076977336 11:184251-184273 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1077164212 11:1127838-1127860 CTGAAATACTGAAAGGAGGAAGG + Intergenic
1077829653 11:5852533-5852555 GAGGACTACTAGAGGGAGGAGGG - Intronic
1077937689 11:6806419-6806441 GTGGGTTACTAGAGGGAGGAGGG - Intergenic
1078797257 11:14604716-14604738 GGGAATTACCAGAGGAAGGAGGG - Intronic
1079239826 11:18714525-18714547 CTGAATGACGAGAAGGTGGAGGG - Exonic
1080045275 11:27801437-27801459 CTAAATTCCAAAAGGGAGGAGGG + Intergenic
1080881700 11:36327320-36327342 CTGAAATTCCAAAGGGAGGAGGG - Intronic
1080950475 11:37026527-37026549 CTGAATTCCAGAAGGGAGGAAGG - Intergenic
1081233887 11:40621638-40621660 CTGAATTTCAAGATGCAGGAGGG + Intronic
1081259846 11:40946089-40946111 GAGGACTACTAGAGGGAGGAGGG - Intronic
1081704057 11:45170437-45170459 GTGAATGCCTAGAGGGAGTAGGG + Intronic
1082937950 11:58674150-58674172 CTGAATTACTCAAGTGGGGAGGG - Intronic
1082957827 11:58890101-58890123 GTGGACTACTAGAGGGTGGAGGG - Intronic
1083389772 11:62339351-62339373 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1083513831 11:63237179-63237201 GTGGACTACTAGAGGGAGGAAGG + Intronic
1084025450 11:66445629-66445651 CTGAATTCCAAAAGGGAGAAGGG - Intronic
1084025850 11:66448879-66448901 CTGAATTCCAAAAGGGAGAAGGG - Intronic
1084324016 11:68388663-68388685 CTGAGCACCTAGAGGGAGGAAGG - Intronic
1084606694 11:70176644-70176666 TTGAATTCCAAAAGGGAGGAGGG + Intronic
1085782179 11:79419478-79419500 CTGACTTACTAGACAGAGCAAGG - Intronic
1086685559 11:89730120-89730142 CTGGACTACTTGAGGGTGGAGGG + Intergenic
1087807638 11:102572297-102572319 CAGAATAACTAAAGGGAGGGAGG - Intergenic
1088313764 11:108486918-108486940 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1088458359 11:110056658-110056680 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1088877711 11:113949621-113949643 CTGAATTCCGAAAGAGAGGAGGG - Intergenic
1089302466 11:117506970-117506992 CTGCATTTCTAGCGGGAGGAAGG - Intronic
1090046493 11:123339739-123339761 GGGAACTACTAGAGGGAGGAGGG + Intergenic
1090096961 11:123751911-123751933 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1090185281 11:124735004-124735026 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1091104254 11:132903554-132903576 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1091242953 11:134066632-134066654 CTGAATTCCAAAAGGGTGGAGGG + Intergenic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1092754854 12:11753665-11753687 CTGAATTACCAGAGAGAGAAAGG - Intronic
1093220539 12:16415279-16415301 CTTAATTTCCATAGGGAGGAGGG + Intronic
1093517204 12:20002701-20002723 CTGAATGACTATGGGGAGAAAGG - Intergenic
1093623747 12:21322710-21322732 CTGAATTCCAAAAGGGAAGAGGG + Intronic
1093624804 12:21332490-21332512 CTGAATTCCAAAAGAGAGGAGGG + Intronic
1095779592 12:46044708-46044730 CTGAATTCTGAAAGGGAGGAGGG - Intergenic
1095903697 12:47355383-47355405 GGGGACTACTAGAGGGAGGAAGG - Intergenic
1098135304 12:67395759-67395781 TTTAATTACAATAGGGAGGATGG + Intergenic
1098321957 12:69254811-69254833 CTAAATTATTTGAGGGAGGGAGG - Intronic
1098831110 12:75364186-75364208 CTGAATTACAAAAGGGAGGAAGG + Intronic
1099050974 12:77781291-77781313 CAGAATTCCAAAAGGGAGGAGGG - Intergenic
1099246277 12:80196918-80196940 CTGAATTATAAAATGGAGGAGGG - Intergenic
1100726517 12:97414569-97414591 CTGAGGTATTGGAGGGAGGAAGG - Intergenic
1100761537 12:97812604-97812626 CTGGAATGCTAGAGGGAAGATGG + Intergenic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1100962309 12:99976185-99976207 GTGGACTACTAGAGGGTGGAAGG + Intronic
1101510014 12:105384538-105384560 ATGAATTAATGCAGGGAGGATGG + Intronic
1101713042 12:107286504-107286526 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
1102416033 12:112763720-112763742 CTGAATTTCAAGAGGGAGGAGGG + Intronic
1102510724 12:113413661-113413683 CTGAAATCCTAGGAGGAGGATGG + Intronic
1102582049 12:113895659-113895681 ATGAATTTCTCCAGGGAGGAGGG + Intronic
1102783094 12:115582664-115582686 ATGAATTATAAGAGGGAGGCTGG + Intergenic
1104143318 12:126008853-126008875 ATGAATTACTTGATTGAGGAGGG + Intergenic
1104168588 12:126257902-126257924 GTGGACTACTAGAGGGTGGAGGG + Intergenic
1104277297 12:127341417-127341439 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1106114695 13:26807106-26807128 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1106566035 13:30885517-30885539 CTGAATTCCAAATGGGAGGAGGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106882720 13:34149374-34149396 CTTAATTTCTAGAGGGAAAATGG + Intergenic
1106900610 13:34351423-34351445 ATGAATGAGTAGAGGGATGATGG + Intergenic
1108248422 13:48540865-48540887 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1108260807 13:48653941-48653963 CTGAATTACTCGGAGGAGAAAGG + Intronic
1108299037 13:49055448-49055470 CTAAATTCCAAAAGGGAGGAGGG - Intronic
1108968760 13:56344938-56344960 CTGAACTACTAGAGTGTGGAGGG + Intergenic
1109442880 13:62398058-62398080 CTGAATTCCCAAAGGAAGGAGGG - Intergenic
1110455240 13:75684026-75684048 CTGAATTCCAAAAGGGAGGGGGG + Intronic
1110702297 13:78562841-78562863 CTGAATAAATAGAGGATGGATGG + Intergenic
1111774282 13:92640006-92640028 CAGAATTAGGAGAGGGAGAAGGG - Intronic
1112079566 13:95954391-95954413 CTGAATTCCAAAAGGAAGGAGGG - Intronic
1112871578 13:103977559-103977581 ATGAACTACTAGAGGAGGGAAGG + Intergenic
1113007550 13:105724217-105724239 CTCATCTACTAGAGGGAGAAGGG - Intergenic
1113535641 13:111064238-111064260 CTGAATTCCAAAAGGGCGGAAGG - Intergenic
1113742725 13:112722541-112722563 CTGAATTCCAAAAGGAAGGAGGG + Intronic
1113742830 13:112723294-112723316 CTGAATGACAAGAGGGCGGGGGG - Intronic
1113842226 13:113366593-113366615 CTGAATTCCTGAAGGGAGGAGGG - Intergenic
1114237904 14:20838174-20838196 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1114441617 14:22752795-22752817 CTGAATTCCAAAAGGGAAGAGGG + Intergenic
1115303461 14:31910896-31910918 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
1115912324 14:38270121-38270143 GGGAATTACTAGAGTGGGGAGGG + Intergenic
1115964083 14:38867270-38867292 GGGAATTCCTACAGGGAGGAAGG - Intergenic
1117622473 14:57601464-57601486 GGGGACTACTAGAGGGAGGAGGG - Intronic
1118891978 14:69917955-69917977 CCACATTACTAGAGGCAGGAAGG - Intronic
1119120904 14:72076136-72076158 TGCCATTACTAGAGGGAGGATGG + Intronic
1119461984 14:74813486-74813508 CTGAATTTCTAGAGTGATTAGGG - Intronic
1119745459 14:77040644-77040666 CTCACTGACTAGAGGGAGGAGGG - Intergenic
1120351643 14:83368114-83368136 CGGAATTACAAAAGGGTGGAAGG + Intergenic
1120402015 14:84043995-84044017 CGTAATTTCAAGAGGGAGGAGGG - Intergenic
1120622988 14:86789047-86789069 CTGTATTCCAAAAGGGAGGAGGG - Intergenic
1121377108 14:93422469-93422491 CTGAATTCCAAAAGGAAGGAGGG + Intronic
1121406635 14:93723069-93723091 CTGAACAACTTGAGGGAGGGAGG - Intronic
1121927145 14:97938126-97938148 TTGAATAACTAGAAGTAGGAAGG + Intronic
1124075945 15:26444309-26444331 CTGAATTCCAAAAGGGAGGATGG + Intergenic
1125056538 15:35364864-35364886 CAGAAAGACTAGAGGGAGAATGG - Intronic
1125182500 15:36893745-36893767 CTGCATTAGTAAAGGAAGGAAGG + Intronic
1126674817 15:51151732-51151754 AAGAACTACTAGAGGGAGGAGGG + Intergenic
1126704917 15:51397683-51397705 TTGTTTTAATAGAGGGAGGAGGG + Intronic
1127487878 15:59436385-59436407 CTCAAGTAGTAGAGGGAGTAGGG + Intronic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1127901254 15:63342605-63342627 CTAAATTCCAAAAGGGAGGAGGG + Intronic
1134073334 16:11273870-11273892 TTGAATTTCTAGAAGCAGGAGGG + Intronic
1134612380 16:15619515-15619537 CTGAAGTGCTGGAGGAAGGAGGG - Intronic
1134675821 16:16089963-16089985 CTGAATGACAAGAGGTAGGGAGG - Intronic
1135020817 16:18961664-18961686 CTGGAGTTCTAGAGAGAGGATGG - Intergenic
1137949923 16:52774032-52774054 CTGATTTGGTAGAGAGAGGAGGG - Intergenic
1138633292 16:58316514-58316536 CTGAATTCCAGAAGGGAGGAGGG - Intronic
1138748240 16:59388677-59388699 CTGAATTTCAAAATGGAGGAGGG + Intergenic
1138932523 16:61677876-61677898 CTTAATTCCAAAAGGGAGGAGGG - Intronic
1139249322 16:65479880-65479902 CTGAAGAAATAGAGGTAGGAGGG + Intergenic
1140418597 16:74797020-74797042 TTGAATTCCCAGAGGGAGGGAGG + Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1141241168 16:82266599-82266621 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1141332735 16:83126959-83126981 ATGAAGGAGTAGAGGGAGGAGGG + Intronic
1142442916 16:90112431-90112453 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1203141176 16_KI270728v1_random:1767805-1767827 CTGTGTTACTGGTGGGAGGAGGG + Intergenic
1142464787 17:128961-128983 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1142512691 17:407429-407451 GGGGACTACTAGAGGGAGGAGGG + Intergenic
1143815018 17:9506073-9506095 ATGGATTATTAGAGGGAGTAAGG - Intronic
1144103368 17:11963495-11963517 CTGGATTATTAGAGGGTGTAGGG + Intronic
1145223363 17:21107304-21107326 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1147656623 17:42094846-42094868 CTGGCTTACTAGAGGGTGGCTGG - Intergenic
1148666597 17:49379561-49379583 CTCAATTTCTAAAGGGAGAAAGG - Intronic
1148978559 17:51550727-51550749 CTGAATCACTAAAGGGAGGAAGG + Intergenic
1149079382 17:52635426-52635448 GTGGATTACTAGAGGGGAGAGGG + Intergenic
1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG + Intronic
1149933693 17:60781980-60782002 CTGAATTTCTAGGTGGAGGATGG - Intronic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1152823902 17:82451691-82451713 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1153141830 18:1981353-1981375 GTGGCCTACTAGAGGGAGGATGG - Intergenic
1153867993 18:9290883-9290905 CTGACTTCCCAAAGGGAGGAGGG - Intergenic
1153887111 18:9476362-9476384 CAGAATTACTTCAGGGAAGACGG - Intronic
1154373932 18:13793239-13793261 CTGAAATCCAAAAGGGAGGAGGG - Intergenic
1155514058 18:26606266-26606288 CTGAATTTCAAAAGGGAGGAGGG + Intronic
1156297885 18:35809178-35809200 GTGGAAAACTAGAGGGAGGAAGG - Intergenic
1156963964 18:43067767-43067789 CTGAATTCCAAAAGGGAGGAAGG + Intronic
1157084007 18:44558808-44558830 CTCAATTACTTCAGGAAGGAAGG - Intergenic
1157907003 18:51578067-51578089 CTGAATGACTGCATGGAGGAGGG + Intergenic
1157945819 18:51979594-51979616 GTGGACTACTAGAGGGTGGAGGG + Intergenic
1157954726 18:52084169-52084191 CTGAATTCCAAAAGGAAGGAAGG - Intergenic
1158617484 18:59001584-59001606 CTGAATTCTGAAAGGGAGGAGGG + Intergenic
1159254028 18:65922077-65922099 GTGAACTACCAGAAGGAGGAGGG - Intergenic
1159482127 18:69002962-69002984 TTGACTTACTCGAGGGAGAAGGG - Intronic
1159817247 18:73090551-73090573 GTGGACTACTAGAGGGTGGAGGG + Intergenic
1160067854 18:75594175-75594197 CTGGTTTACAAGATGGAGGAAGG + Intergenic
1164613616 19:29650907-29650929 CTGAATTCCAAGAGGGAGGAGGG + Intergenic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1167201101 19:48066137-48066159 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1168513260 19:56990324-56990346 GTAGACTACTAGAGGGAGGAGGG + Intergenic
925627051 2:5851985-5852007 CTGAATGACTAAATGTAGGATGG - Intergenic
926033546 2:9614843-9614865 CTGATAGACTAGAGGCAGGAAGG - Intronic
926298491 2:11585561-11585583 CTGAACTACTGGGGGAAGGATGG + Intronic
926418151 2:12671144-12671166 CTGAATCAGGAGTGGGAGGATGG - Intergenic
928682063 2:33712765-33712787 CTGAATTCCAAGAGGTAGGAGGG - Intergenic
931194093 2:60034311-60034333 ATGGACTACTAGAGGGTGGAGGG - Intergenic
931654559 2:64499205-64499227 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
931998207 2:67859099-67859121 CTGAATCACCATATGGAGGATGG + Intergenic
935092536 2:99909392-99909414 ATGAGTTACTGGAGGGAGGGGGG + Intronic
935379620 2:102438403-102438425 CTGAAGTGCTAGAGGGTGCAAGG - Intronic
936481198 2:112886375-112886397 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
937098005 2:119248222-119248244 CTGAGTTGCCAGAGGGAGGAAGG - Intronic
937651813 2:124327475-124327497 CTGAATTACAAAACTGAGGAGGG - Intronic
937770545 2:125715633-125715655 GTGAACTACTAGAGGGGAGAGGG + Intergenic
938794913 2:134709760-134709782 CTGAATTCCAGAAGGGAGGAGGG - Intronic
938966457 2:136392995-136393017 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
940318241 2:152347161-152347183 CTGAAGAACAAGAGGGAGGGAGG - Intronic
941051016 2:160734313-160734335 GTTAATTAATAGAGGGAGAAGGG - Intergenic
942022494 2:171880712-171880734 ATGGATGACTAGAGGGAGAAAGG - Intronic
942605040 2:177681747-177681769 CTGAATTCCAAAAGGGAGGAAGG - Intronic
942785234 2:179693328-179693350 CTGAATGACTGAAGGGAGAAGGG + Intronic
943079656 2:183242966-183242988 CTGAATGACTAAAGGGAGCACGG + Intergenic
943657181 2:190522068-190522090 AGGAATTAATAGAGGGAGGAGGG + Intronic
943657250 2:190522611-190522633 CTGAATTCCAAAAGGGAGGAGGG - Intronic
943931392 2:193858169-193858191 CTGGCTTACTAGAGCCAGGATGG - Intergenic
945000229 2:205342117-205342139 CTGTATGACTAAAGGGAGGAAGG + Intronic
945524653 2:210873104-210873126 CTGATTTACTAGAAGAATGAAGG - Intergenic
946944734 2:224808973-224808995 CTGAAGTATTTGAGGGAGCAAGG + Intronic
947226908 2:227849374-227849396 CTGAATTCCAAAAGGAAGGAGGG - Intergenic
1168733542 20:109447-109469 GTGGATTACTAGAGGGAGGAGGG + Intergenic
1169261535 20:4142320-4142342 CTGAATCACTATGTGGAGGAAGG + Intronic
1169538333 20:6571527-6571549 GTGGATTACTAGAGTGGGGAGGG + Intergenic
1169689852 20:8318304-8318326 CTGATTTTCTAGTGGGAGAAGGG + Intronic
1170075905 20:12418736-12418758 CAGATCTACTTGAGGGAGGAAGG + Intergenic
1170646987 20:18206613-18206635 ATGAATTATTAGAGTGAGGAGGG + Intergenic
1170823772 20:19776206-19776228 CTGAATTCCCAAAGGGAGGAGGG - Intergenic
1171794613 20:29557066-29557088 CTGATTTAGTAGAGGGTGAAGGG - Intergenic
1171853840 20:30327198-30327220 CTGATTTAGTAGAGGGTGAAGGG + Intergenic
1171974489 20:31585731-31585753 CTGAATTCCAAAAGGAAGGAGGG - Intergenic
1173154663 20:40597588-40597610 GTGGACTACTAGAGGGTGGAGGG + Intergenic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1174692302 20:52518435-52518457 GGGAATTACTAGAGGGCAGAGGG - Intergenic
1174839278 20:53886362-53886384 TTGAATTACAAAAGGGAGGAGGG - Intergenic
1174888591 20:54364034-54364056 CTGAATTTCAAAAGGGAGGAGGG - Intergenic
1175728774 20:61337857-61337879 CAGAATTACCAGAGGAAAGAAGG - Intronic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1178570597 21:33732298-33732320 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1178814461 21:35915296-35915318 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1178897385 21:36570351-36570373 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1181344011 22:22203832-22203854 CTGAACTACTAGAGGGAGGCTGG + Intergenic
1181928946 22:26383801-26383823 CTGAGCTAAGAGAGGGAGGATGG - Intergenic
1182157755 22:28091687-28091709 CTCAAATACTTGTGGGAGGAGGG - Intronic
1182455440 22:30447532-30447554 CTGAATTCCGAAAGGGAGGAGGG + Intergenic
1182750490 22:32637973-32637995 CTGAACTACTAAAGGGAAGAGGG - Intronic
1183113976 22:35675408-35675430 CTGAATTCCAAAAGAGAGGAGGG - Intergenic
1183306033 22:37083733-37083755 CTTAGTTACCAGAGGGAGCAAGG + Intronic
1183788699 22:40047215-40047237 TTGAATTATCAGAGGGAGAAAGG + Intronic
1185214689 22:49591703-49591725 CTGACTTTCCAAAGGGAGGAGGG - Intronic
949403329 3:3688436-3688458 CTGTATTCCAAAAGGGAGGAGGG + Intergenic
950425957 3:12924860-12924882 CTGAATGCCTACAGGGATGAAGG - Intronic
950705366 3:14776218-14776240 CTGAAACACAAGAGGAAGGAGGG + Intergenic
950714956 3:14841514-14841536 ATGGATTACTGGAGAGAGGAAGG + Intronic
952030449 3:29135840-29135862 GAGGACTACTAGAGGGAGGAGGG + Intergenic
952579796 3:34819357-34819379 GTGAACTACTAGAGGGGGAAGGG - Intergenic
952688004 3:36171956-36171978 CTGAATTACAAAAAGGAGGAGGG + Intergenic
953230356 3:41059098-41059120 GGGGACTACTAGAGGGAGGAGGG - Intergenic
953422333 3:42764229-42764251 CTGAATTCCAAAAGGGAGGAGGG + Intronic
953454033 3:43028270-43028292 CTAAATTTCAAAAGGGAGGACGG + Intronic
954923502 3:54212601-54212623 CTGAATTCCAAAAGGGAGGAGGG + Intronic
957772820 3:84716440-84716462 GTGGACTACTAGAGGGTGGAAGG + Intergenic
957903168 3:86523728-86523750 CTGAATTCGAAGATGGAGGATGG - Intergenic
958989990 3:100831705-100831727 CTGGATGAGTAGAGGGATGAGGG - Intronic
959752850 3:109858843-109858865 CTGAATTCCAAAAGGAAGGAGGG + Intergenic
959817925 3:110697881-110697903 CTGAGTTTCCAGAGGGAGCATGG - Intergenic
959912494 3:111779401-111779423 GGGGACTACTAGAGGGAGGAGGG - Intronic
960858409 3:122126567-122126589 GAGAATTAGTAGTGGGAGGATGG + Intergenic
961570578 3:127795384-127795406 GGGAATTACTAGAGGGGGAAGGG + Intronic
961790420 3:129371961-129371983 GAGGACTACTAGAGGGAGGAGGG - Intergenic
961957441 3:130818564-130818586 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
962040910 3:131706616-131706638 CTGAATCCCAAAAGGGAGGAGGG - Intronic
964276253 3:155011810-155011832 ATGAATTACGAAAGGGAGTAGGG + Intergenic
964530977 3:157667481-157667503 CAGAATTAAAAGATGGAGGAAGG + Intronic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
967038259 3:185664496-185664518 GTGAATTAATGGAGGGAGAAGGG + Intronic
967616718 3:191577833-191577855 CTGGATTTCTAGAGGGAGTGGGG + Intergenic
967862103 3:194160088-194160110 CAGATTTCCTAGAGTGAGGAAGG + Intergenic
967970693 3:194996930-194996952 CTGAATAAATGAAGGGAGGACGG + Intergenic
968363188 3:198163391-198163413 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
969516464 4:7650942-7650964 CTGCATTTCTCAAGGGAGGATGG - Intronic
970205685 4:13653564-13653586 CTGAATTCCTAAAGAGAGTAGGG - Intergenic
971828164 4:31654879-31654901 CTGAATTACTAGAGTGTCAAAGG + Intergenic
972170958 4:36344663-36344685 CTGAATTCCAAAAGAGAGGAGGG + Exonic
973264838 4:48200774-48200796 CTGAATTGCAAGCTGGAGGAAGG - Intronic
973759524 4:54103505-54103527 CTGAGTTACTAGAGGCCGGTCGG + Intronic
974499677 4:62684085-62684107 CTGAACTACTGGAGGGGGAAGGG + Intergenic
975002457 4:69241315-69241337 CTGAATTCAAAAAGGGAGGAGGG + Intergenic
975007440 4:69308458-69308480 CTGAATTCAAAAAGGGAGGAGGG - Intronic
975010562 4:69345297-69345319 CTGAATTCAAAAAGGGAGGAGGG + Intronic
977710870 4:100123588-100123610 CTGTCTTACTTGAGGGAGGCAGG + Intergenic
978423044 4:108554253-108554275 CTGAATTCCAAAAGGGAGGACGG - Intergenic
978638227 4:110837552-110837574 CTAAATTACTAGAGGTAGGGTGG + Intergenic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
980492023 4:133540737-133540759 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
980639074 4:135550654-135550676 CTGAATAAATAAAGGTAGGATGG - Intergenic
981425637 4:144599851-144599873 CTGACTCACTATAGGGAGAAAGG + Intergenic
982449322 4:155533246-155533268 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
982533241 4:156574318-156574340 GGGAACTACTAGAGGGAGGGGGG + Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
985504207 5:269678-269700 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
985558215 5:568495-568517 CTGAAACCCTAGAGAGAGGAGGG - Intergenic
985659044 5:1146602-1146624 CTAAATTCCGAAAGGGAGGAGGG - Intergenic
986426907 5:7641679-7641701 TGGGACTACTAGAGGGAGGAGGG - Intronic
987539553 5:19236424-19236446 TTGGATTACCAGAGGGAGGGGGG + Intergenic
987542289 5:19271160-19271182 CTGAATTCCAAAAGGGAGGAAGG + Intergenic
988114855 5:26873113-26873135 CTAAATGGCTAGAGAGAGGAAGG + Intergenic
988320761 5:29693264-29693286 GTGGACTTCTAGAGGGAGGAGGG - Intergenic
988830654 5:34984024-34984046 CTTCATTTCTAGAGAGAGGAGGG - Intergenic
991056459 5:62325968-62325990 TGGGATTACTAGAGGAAGGAGGG + Intronic
992108037 5:73466557-73466579 CTGAATTCCAGTAGGGAGGAGGG + Intergenic
992542656 5:77779911-77779933 TTGAATTACAAAAGAGAGGAGGG - Intronic
992583667 5:78209243-78209265 CTGAATTCCAAAAGGGAGGAGGG - Intronic
993086466 5:83369404-83369426 GTGAACTACTAGACGGGGGAGGG - Intergenic
994560217 5:101360023-101360045 CTGAATTACTTGACAGATGAGGG + Intergenic
994603417 5:101937002-101937024 GAGGATTACTAGAGGGCGGAGGG - Intergenic
994855115 5:105110749-105110771 TTGAATTCCTAGAGTGAGTATGG + Intergenic
995260076 5:110093479-110093501 GGGAGTTACTAGAGGGAGAAGGG + Intergenic
995288680 5:110423155-110423177 CAGAATTAGAAGTGGGAGGATGG - Intronic
995785182 5:115820122-115820144 GGGGATAACTAGAGGGAGGATGG - Intergenic
996266642 5:121549221-121549243 CTGAATTAGTGGAGGAAAGAAGG - Intergenic
996526346 5:124484148-124484170 GTGTACTACTAGATGGAGGAGGG - Intergenic
996688716 5:126313938-126313960 CTGGATTCCAAGAGGGAGGAGGG + Intergenic
997174446 5:131760076-131760098 GTGGACTACTAGAGGGAAGAGGG + Intronic
999942923 5:156563911-156563933 CTGAAGAACTTGAGGGAGTAGGG - Intronic
1000763416 5:165254814-165254836 CTGAAATAATAAAGGGAGGAAGG - Intergenic
1001282629 5:170398116-170398138 CTGAAATCCAAAAGGGAGGAGGG + Intronic
1003790694 6:9544068-9544090 CTGAATGACAAGAGGCAGGTCGG + Intergenic
1004200879 6:13546803-13546825 CTGAATTACAAAAGGGAGGAGGG - Intergenic
1005665354 6:28047214-28047236 GTGAATAACTGGAGGGAGGCTGG - Intergenic
1006051673 6:31350145-31350167 CTGAATTCCAAGAGGGAAGAGGG + Intronic
1006702235 6:35984891-35984913 CTGAATTCCAAAAGGGTGGAGGG - Intronic
1007115785 6:39342382-39342404 CTGACATTCTAGGGGGAGGAAGG - Intronic
1007373524 6:41442096-41442118 CTGGACTATGAGAGGGAGGAGGG - Intergenic
1007807369 6:44460384-44460406 CTGAATTCCTAGAAGGAGACAGG + Intergenic
1008730264 6:54473579-54473601 CTGAATTCCAAAAGGGAAGAGGG - Intergenic
1009376204 6:62973156-62973178 ATGAATTACCAGGGGGAGAATGG + Intergenic
1011233958 6:85194513-85194535 CTGAGTTGATAGAGGTAGGAAGG + Intergenic
1012205797 6:96458911-96458933 CTGAATTCCAAAAGGGACGAGGG + Intergenic
1012383079 6:98643369-98643391 TTACATTACTGGAGGGAGGAAGG + Intergenic
1013479278 6:110539285-110539307 GTGGACTACTAGAGGGAGGAGGG - Intergenic
1013547785 6:111176168-111176190 GTGGATTAGTAGAGGGAGAAGGG + Intronic
1014171963 6:118288670-118288692 CTGAATTCCAAAAGGAAGGAGGG + Intronic
1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG + Intronic
1016964825 6:149709204-149709226 CTGAATTCCAACAGGGAGGAGGG - Intronic
1017237262 6:152129782-152129804 CTGAATTCCTGGAAGGAGGGTGG - Intronic
1017815392 6:158012456-158012478 CTGAATTTGAAGAGGAAGGAAGG + Intronic
1018138986 6:160807745-160807767 CTGAATTACAAAAGGGAAGATGG - Intergenic
1019252492 7:25320-25342 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1019409483 7:900358-900380 CTGAAGTTCTAGAGTGAGGCAGG + Intronic
1020638688 7:10728453-10728475 GTGAACTACTAGTGGGTGGAGGG - Intergenic
1020808436 7:12820908-12820930 CTGAATTCCAAAAGGGAAGAGGG - Intergenic
1021085479 7:16417624-16417646 GGGGATCACTAGAGGGAGGAGGG + Intronic
1021099397 7:16571309-16571331 CTGAATTCCAAAAGGGAGGGGGG - Intronic
1021578646 7:22129050-22129072 CTGGATTACTGGAGAGAGCAGGG + Intronic
1021811594 7:24407055-24407077 CTGCATTCCTAGAGGAATGAAGG + Intergenic
1022464884 7:30646957-30646979 CTGAATGGCCAGAGGGAGTACGG + Intergenic
1022985448 7:35649861-35649883 CTGAATTCCAAAAGGGAAGAGGG + Intronic
1023572451 7:41586237-41586259 TTGAGTTACTACATGGAGGAGGG - Intergenic
1024191603 7:47017175-47017197 CTGAATAACAAAAGGGAAGATGG + Intergenic
1026486625 7:70827268-70827290 GGGGATTACTAGAGGGTGGAAGG - Intergenic
1026575131 7:71565451-71565473 ATGAAGTGCTAGAGAGAGGAAGG - Intronic
1026606435 7:71819996-71820018 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1026890095 7:73976885-73976907 CTGAATTTCTAGAGCTGGGAAGG - Intergenic
1028921327 7:96313600-96313622 GGGGACTACTAGAGGGAGGAGGG + Intronic
1029455770 7:100671255-100671277 GGGGATTACTAGAGGGGGGAAGG - Intergenic
1030745850 7:113165572-113165594 CTGAATTGCGGGAGGGAGCAAGG + Intergenic
1031824257 7:126543354-126543376 CAGAATCACTAGAGGAAGGAGGG - Intronic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1032574060 7:133033861-133033883 CTGATGTCCTAGAGGGATGAGGG + Intronic
1032593830 7:133218915-133218937 AGGAACTACTAGAGGGAGGAGGG - Intergenic
1032822541 7:135537731-135537753 ATGAAATAATACAGGGAGGAAGG + Intergenic
1032827714 7:135588543-135588565 TTGAATTATTAGAGGCAGAAAGG + Intronic
1033390824 7:140925243-140925265 TTGAAATCCTAGAGGGAGGAAGG + Intergenic
1034291111 7:149932657-149932679 CTTAATTCCTGGAGGAAGGAGGG + Intergenic
1034814992 7:154164280-154164302 CTTAATTCCTGGAGGAAGGAGGG - Intronic
1036278912 8:7381732-7381754 GTGAACTACTAGAGGGTGGAGGG + Intronic
1036342608 8:7930134-7930156 GTGAACTACTAGAGGGTGGAGGG - Intronic
1036479308 8:9124098-9124120 CTGAATTAGGAAAGAGAGGAAGG + Intergenic
1038050229 8:23802113-23802135 TTGGACTACTAGAGGGAGGGAGG - Intergenic
1038739506 8:30204578-30204600 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1039722202 8:40176245-40176267 CTGAATTCCAAAAGGGAGGAAGG - Intergenic
1040020884 8:42739904-42739926 CTGAATTCCAAAAAGGAGGAGGG + Intergenic
1040417581 8:47208732-47208754 CTGAATTCCAAAAGGAAGGAAGG - Intergenic
1042423600 8:68620457-68620479 CTGTATTACCAGAGTGAGCAAGG + Intronic
1042933487 8:74035610-74035632 CTGAATTCCAAAAGGGAAGAGGG - Intergenic
1043374726 8:79635744-79635766 GTGGACTACTAGAGGGGGGAAGG + Intronic
1045236325 8:100355629-100355651 CTCAATTCCTAGAGCGAGAAGGG - Intronic
1045391425 8:101718782-101718804 CTGAATTCCAAGAGGAAGGAGGG - Intronic
1045533523 8:103006085-103006107 CTGAATTCCAAAAGGGAGGATGG + Intergenic
1046474586 8:114725256-114725278 CTGGCCTACTTGAGGGAGGAGGG + Intergenic
1047055157 8:121155730-121155752 CTGAATTCCAAAAGGAAGGAGGG - Intergenic
1047359621 8:124156172-124156194 GGGGACTACTAGAGGGAGGAGGG - Intergenic
1047360485 8:124164515-124164537 TTGAATTAACAAAGGGAGGAGGG - Intergenic
1048316619 8:133367833-133367855 CTGGATTTCAAGAGGGAGGAAGG + Intergenic
1048671454 8:136727777-136727799 TTGAATTCCAAAAGGGAGGAAGG + Intergenic
1048920022 8:139219672-139219694 CTGAATGAAGAGAGGGAGGGAGG - Intergenic
1049426470 8:142540134-142540156 CTAAATGACCAGAGGGAGCATGG - Intronic
1049467588 8:142759121-142759143 CTGAATTCCAGGAGGGAGGAGGG - Intergenic
1050178010 9:2889527-2889549 GTGGATTACTAGAGTGGGGAGGG + Intergenic
1051580402 9:18667121-18667143 CTGAATTCCTTGAGGGAAGGGGG - Intronic
1052718635 9:32148228-32148250 GTGGACTACTAGAGGGTGGAGGG - Intergenic
1053095081 9:35319570-35319592 GTAGACTACTAGAGGGAGGAAGG - Intronic
1053594273 9:39544043-39544065 CTGAATTCCAAGAGGAAAGAGGG - Intergenic
1053791639 9:41690490-41690512 CTGATTTAGTAGAGGGTGAAGGG + Intergenic
1053852054 9:42299088-42299110 CTGAATTCCAAGAGGAAAGAGGG - Intergenic
1054180042 9:61902505-61902527 CTGATTTAGTAGAGGGTGAAGGG + Intergenic
1054571980 9:66820915-66820937 CTGAATTCCAAGAGGAAAGAGGG + Intergenic
1054657551 9:67678636-67678658 CTGATTTAGTAGAGGGTGAAGGG - Intergenic
1055058964 9:72049253-72049275 CTGACTTTGAAGAGGGAGGAGGG - Intergenic
1055067578 9:72134077-72134099 GTGAATTAGTGGAGGGAGTAGGG + Intronic
1055449526 9:76418378-76418400 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1056289221 9:85125925-85125947 CTGAATTCAAAAAGGGAGGAGGG - Intergenic
1056508189 9:87277335-87277357 CTGAATTAAATGAGGGAGGGCGG + Intergenic
1056681982 9:88727369-88727391 CTGAATTCCAAGAGGAAGGAGGG + Intergenic
1056967955 9:91179893-91179915 CAGAATTATTTGGGGGAGGAGGG + Intergenic
1056995344 9:91452116-91452138 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1057519728 9:95751610-95751632 CTGAGCTGCAAGAGGGAGGATGG + Intergenic
1058102462 9:100932409-100932431 GGGAACTACTAGAGGGGGGAGGG - Intergenic
1058125494 9:101189464-101189486 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1058301082 9:103373713-103373735 CTAAATTCCGAAAGGGAGGAGGG - Intergenic
1059220440 9:112611782-112611804 CTGAAATAATAGAGTAAGGAGGG + Intronic
1059408152 9:114115180-114115202 CTGAATCCCAAAAGGGAGGAGGG + Intergenic
1059823885 9:118005163-118005185 CTCAATTACTCAAGAGAGGAAGG - Intergenic
1061657613 9:132104804-132104826 CTGGGTTCCTAGAGGTAGGAGGG + Intergenic
1062712048 9:137980666-137980688 GGGGAGTACTAGAGGGAGGAGGG - Intronic
1062747875 9:138227051-138227073 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1185817358 X:3168727-3168749 CTGAATTCCAAAAAGGAGGAGGG + Intergenic
1185924403 X:4130669-4130691 CTGAGATGCAAGAGGGAGGAAGG - Intergenic
1186152828 X:6693221-6693243 CTGAATTCCACAAGGGAGGAAGG + Intergenic
1186156956 X:6735661-6735683 ATGAATTACTACAAGGTGGAGGG - Intergenic
1186428716 X:9486057-9486079 ATGAATTCCAAAAGGGAGGAGGG - Intronic
1186603702 X:11066244-11066266 GGGAATTACTAGAGAGGGGAGGG - Intergenic
1186873301 X:13793052-13793074 CTGAATTCCAGAAGGGAGGAGGG - Intronic
1187013076 X:15299593-15299615 CTGAGTTCCAAAAGGGAGGAGGG + Intronic
1187142865 X:16611025-16611047 GGGAACTACCAGAGGGAGGAAGG + Intronic
1188580587 X:31707457-31707479 GGGGACTACTAGAGGGAGGAGGG + Intronic
1188724076 X:33559870-33559892 GTGAACTGCTAGAGAGAGGAGGG - Intergenic
1188876209 X:35433555-35433577 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1188876983 X:35442272-35442294 CTGAATTCCAAAAGGCAGGAAGG + Intergenic
1189188081 X:39071140-39071162 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
1189424624 X:40886986-40887008 GAGGACTACTAGAGGGAGGAGGG - Intergenic
1189444819 X:41070776-41070798 CTGAATGACTGCATGGAGGAAGG - Intergenic
1189758752 X:44299286-44299308 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1190037512 X:47039560-47039582 GGGGATTACTAGAGGGAGGAGGG - Intronic
1190132901 X:47767865-47767887 GTGAACCACTAGAGGGTGGAGGG - Intergenic
1190391430 X:49935596-49935618 CTGAATTTATAGAGAGAAGAAGG + Intronic
1190408244 X:50109190-50109212 CTGAATTCCAAAAGGAAGGAGGG - Intergenic
1190759262 X:53426184-53426206 CTGAAATATTATAGGGAGAAAGG + Intronic
1192088401 X:68125789-68125811 CTGAAAAAATAGAGGGGGGAGGG + Intronic
1192283048 X:69704496-69704518 CTGAATTTCAAAAGGGGGGAGGG + Intronic
1193959208 X:87902625-87902647 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1194092273 X:89592605-89592627 CTGAATTCCAAAGGGGAGGAGGG - Intergenic
1194175273 X:90638704-90638726 GTGGAATACTAGAGGGTGGAGGG + Intergenic
1194180731 X:90708673-90708695 CTAGACCACTAGAGGGAGGAGGG - Intergenic
1194824137 X:98540964-98540986 CTGAATTTTAAAAGGGAGGATGG + Intergenic
1195599094 X:106726259-106726281 CTGATTCTCTAGAGGGGGGAAGG - Intronic
1197351370 X:125387551-125387573 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1197576450 X:128218075-128218097 GTGGACTACTAGAGGGAGGATGG + Intergenic
1198982855 X:142419060-142419082 CTGAATTCCAAAAGGGAGGGGGG - Intergenic
1200293359 X:154892864-154892886 CTGAATTCCAAAAGGGAGGCGGG - Intronic
1200444904 Y:3248642-3248664 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1200521922 Y:4219674-4219696 GTGGAATACTAGAGGGTGGAGGG + Intergenic
1200527394 Y:4290829-4290851 CTAGACCACTAGAGGGAGGAGGG - Intergenic
1201290130 Y:12414667-12414689 CTGAATTCCAAAATGGAGGAGGG - Intergenic
1201293710 Y:12446396-12446418 GTAAATTACTAGAGTCAGGAGGG - Intergenic
1201484167 Y:14474612-14474634 GGGGACTACTAGAGGGAGGAAGG - Intergenic