ID: 1149520800

View in Genome Browser
Species Human (GRCh38)
Location 17:57316959-57316981
Sequence GCACCTAGGGAGATAGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149520800 Original CRISPR GCACCTAGGGAGATAGAATC AGG Intronic
903098639 1:21007149-21007171 GCACTTTGGGAGATAGAGACAGG + Intronic
903115110 1:21172892-21172914 GCACTTTGGGAGGTAGAAGCAGG + Intronic
903170446 1:21549211-21549233 TCACCTAGGGAGAGGGAATGGGG - Intronic
903848307 1:26291264-26291286 GCACCTGGGGAGAGAGGAACGGG + Intronic
903928820 1:26850539-26850561 GCGCCTGGGGAGAAAGAAACAGG - Exonic
905760912 1:40557219-40557241 GCACTTTGGGAGATAGAGGCAGG + Intergenic
907206616 1:52777686-52777708 GCACTTTGGGAGGTAGAAGCAGG - Intronic
908041078 1:60114013-60114035 GCACTTAGGAAGAAGGAATCAGG + Intergenic
908063572 1:60377941-60377963 GCACCTTGGGAGGTAGAGGCAGG + Intergenic
908765991 1:67555089-67555111 GCATCTAGGGTGATAGATTCAGG - Intergenic
909195450 1:72615825-72615847 GCAATTAGAGAGATAGAATGGGG + Intergenic
916102120 1:161401598-161401620 GCACTTTGGGAGATAGAGGCAGG + Intergenic
916228971 1:162520138-162520160 GCACTTAGGGAGACTGAATCGGG - Intronic
916394265 1:164368417-164368439 GCACTTTGGGAGATTGAAGCAGG - Intergenic
916593996 1:166224987-166225009 GCAGCTAGAGAGATAGAGGCAGG - Intergenic
916697215 1:167251150-167251172 GCACTTTGGGAGACAGAAGCAGG + Intronic
918941961 1:191011649-191011671 GCACTTAGGGAGACAGAGGCAGG - Intergenic
919180008 1:194068576-194068598 GCAACTTGGAAGATAGAAGCTGG + Intergenic
920026808 1:203004854-203004876 GCACCTAGGGAGGTGGAGGCGGG - Intergenic
921903429 1:220472035-220472057 GCACCTTGGGAGATTGAGGCGGG - Intergenic
922614509 1:226953762-226953784 GGACCTCGCGAGATAGAAGCCGG + Intronic
924662034 1:246029423-246029445 GCACCTTGGGAGACAGAGGCGGG + Intronic
1065298937 10:24303260-24303282 GCACTTAGGGAGATCGAGGCAGG - Intronic
1066107517 10:32168701-32168723 GCACTTTGGGAGACAGAAGCAGG + Intergenic
1067072552 10:43145656-43145678 GCACCTTGGGAGGTTGAAGCAGG - Intronic
1067395182 10:45909237-45909259 GCACTTTGGGAGATAGAAGCAGG + Intergenic
1067863501 10:49878369-49878391 GCACTTTGGGAGATAGAAGCAGG + Intronic
1068594508 10:58888245-58888267 CCACCTAGGGAGGTAGATCCAGG - Intergenic
1069063677 10:63920212-63920234 TCACCTACGCAGCTAGAATCTGG + Intergenic
1070586260 10:77769005-77769027 GCACCTTGGGAGATTGAGGCGGG + Intergenic
1072682750 10:97518328-97518350 GCAGCTAGGGAGAAAGAACCAGG - Intronic
1073218106 10:101847864-101847886 GCTCCTGGGGAGGTAGAAGCAGG + Intronic
1073277498 10:102325151-102325173 GCACTTAGGGAATTAGATTCGGG - Intronic
1074220095 10:111428245-111428267 GCACTTTGGGAGATCGAAGCAGG + Intergenic
1074820807 10:117176950-117176972 GCACTTTGGGAGACAGAAACAGG - Intergenic
1075907994 10:126099053-126099075 GCACCTAGGGAGGAAGCTTCTGG + Intronic
1079226070 11:18605922-18605944 GCACTTTGGGAGGTAGAAGCAGG - Intergenic
1080312501 11:30911461-30911483 GCACAGAGGGAGATCTAATCTGG - Intronic
1083321068 11:61847178-61847200 GCACTTTGGGAGACAGAAGCGGG - Intronic
1084121239 11:67070281-67070303 GCACCTAGGGAGAAACTATTTGG - Intronic
1084671148 11:70607354-70607376 GCACATAGGGAGAGAGGAGCCGG - Intronic
1084725308 11:70938043-70938065 GCTCCTAGGGAGGCAGAAGCTGG - Intronic
1084920475 11:72465401-72465423 GCACTTTGGGAGGTAGAGTCGGG - Intergenic
1084945704 11:72637222-72637244 GCAACGAGGGAGATAAACTCAGG - Intronic
1085018789 11:73192233-73192255 GCACCTTGGGAGGCAGAAGCGGG - Intergenic
1086809694 11:91293150-91293172 GAACTTAGGGAGGTAGAACCTGG - Intergenic
1087050936 11:93885741-93885763 GCACCTTGGGAGACCGAAGCGGG - Intergenic
1087921608 11:103872987-103873009 GCACTTTGGGAGGTGGAATCAGG + Intergenic
1088236170 11:107725773-107725795 GCACTTAGGGAGACCGAGTCTGG - Intergenic
1089012417 11:115141946-115141968 GCCCCTAAGGAGATAGATGCTGG + Intergenic
1090026545 11:123172355-123172377 GCACTTAGGGAGATCGAGGCAGG - Intronic
1090780546 11:130002760-130002782 ACCCCTAGGGAGAGAGGATCGGG - Exonic
1091892468 12:4070661-4070683 GCACTTTGGGAGATAGAGGCAGG - Intergenic
1091911749 12:4237064-4237086 CAACCTATGGAGATTGAATCAGG - Intergenic
1092027458 12:5254647-5254669 CCACCTAGGGAGTAAGAATCAGG + Intergenic
1094068049 12:26382416-26382438 GCACTTTGGGAGATCGAAGCAGG + Intronic
1101698232 12:107147070-107147092 GCCCCTAGGAAGACAGAAACAGG + Intergenic
1103324335 12:120110499-120110521 GCACCTTGGGAGGCAGAAGCGGG - Intronic
1107364110 13:39651597-39651619 GCACTTTGGGAGATAGAGGCAGG - Intergenic
1107742665 13:43468541-43468563 GCTCTTAGGGAGGCAGAATCAGG + Intronic
1109139887 13:58701880-58701902 GAACCAGGGGAGATAGAAACAGG + Intergenic
1109690630 13:65883340-65883362 GCAACTAGGGAGATAAAAATTGG + Intergenic
1110437154 13:75487817-75487839 CCACCTATGGAGATAGCTTCAGG + Intergenic
1112326411 13:98445157-98445179 GCACCCAGAGAGATGGAATGAGG + Intronic
1112606610 13:100912568-100912590 ACATCTTGGGAAATAGAATCAGG - Intergenic
1113426868 13:110215311-110215333 GCACTTTGGGAGATAGAGGCGGG + Intronic
1114841362 14:26266406-26266428 GCAACTTGGGAGACAGAATATGG - Intergenic
1117902393 14:60549183-60549205 GCACTTTGGGAGATGGAAGCAGG + Intergenic
1118185601 14:63534864-63534886 GCACATAGGGAGACAGAGTTGGG - Intronic
1118606482 14:67507679-67507701 GCACTTTGGGAGATGGAAACAGG - Intronic
1121542066 14:94735628-94735650 GACCCTAAGGAGAGAGAATCAGG - Intergenic
1122018882 14:98820081-98820103 GCACCAAGGCAGACAGAAGCAGG - Intergenic
1122393326 14:101405785-101405807 GCATCTAGGCAGAAAGAATAGGG + Intergenic
1127252664 15:57257200-57257222 GCACCTAAGCAGATATAATGGGG + Intronic
1127501157 15:59555346-59555368 GCACTTTGGGAGATGGAAGCAGG - Intergenic
1128669737 15:69566153-69566175 GCACCTTGGGAGACTGAGTCAGG - Intergenic
1130017389 15:80198126-80198148 TCACTTAGGGAAATACAATCTGG - Intergenic
1130528065 15:84724196-84724218 GCACCTTGGGAGGTCGAAGCGGG - Intergenic
1130630473 15:85562958-85562980 GCACCTTGGGAGACCGAAGCAGG - Intronic
1130633690 15:85596357-85596379 GCACTTTGGGAGATCGAAGCAGG + Intronic
1132361540 15:101220300-101220322 GCAGTTAGGGAGATAGAGGCAGG - Intronic
1136508472 16:30721439-30721461 GCATATCGGGAGATAGAATGAGG - Exonic
1139240899 16:65390979-65391001 GCACTTTGGGAGATTGAAGCTGG - Intergenic
1139870326 16:70103342-70103364 GCACCTTGGGAGATCGAGACAGG + Intergenic
1140751640 16:78029612-78029634 GCACTTAGGGAGGCAGAAGCGGG - Intronic
1143312072 17:6000462-6000484 GCACTTTGGGAGGTAGAAGCGGG - Intronic
1144416679 17:15054474-15054496 GCACTTTGGGAGATTGAAACAGG + Intergenic
1145005239 17:19333937-19333959 GCACCTGGGGAGACAGAAGGAGG - Exonic
1145415418 17:22710299-22710321 GCACCCTGGGAGATGGCATCGGG + Intergenic
1145695271 17:26782356-26782378 GCACCCTGGGAGATGGCATCGGG + Intergenic
1146141323 17:30370567-30370589 GCACTTAGGGAGGTAGAGACAGG + Intergenic
1146181300 17:30699824-30699846 GCACTTTGGGAGATAGAGGCTGG - Intergenic
1148125093 17:45232348-45232370 GCTCCTGGGGAGATGGAATGGGG - Exonic
1148213565 17:45822398-45822420 GCACCAAGGGAGAAAGCGTCGGG - Intronic
1149329835 17:55569365-55569387 GCACTTTGGGAGATTGAACCAGG - Intergenic
1149520800 17:57316959-57316981 GCACCTAGGGAGATAGAATCAGG + Intronic
1149526402 17:57359337-57359359 GCTACAAGGGAGATAGAATAGGG + Intronic
1149842044 17:59973998-59974020 GCACTTTGGGAGACAGAGTCGGG - Intergenic
1152773202 17:82183429-82183451 GCACTTAGGGAGGCAGAAGCAGG - Intronic
1153237881 18:3005777-3005799 GCACTTTGGGAGGTAGAAACGGG + Intronic
1154943981 18:21142531-21142553 GCACCTAGGGAGACTGAGGCAGG - Intergenic
1155856097 18:30836662-30836684 GCACTTTGGGAGGTAGAAGCAGG - Intergenic
1156331173 18:36124930-36124952 TCACCTAGGGAGAAAGCCTCAGG + Intronic
1157144562 18:45148536-45148558 GCACCTTGGGAGGTAGAGACAGG + Intergenic
1157823120 18:50788325-50788347 GCACCTGTGGGGATAGAACCAGG - Intergenic
1159209662 18:65301141-65301163 GCACGTTGGGAGACAGAAACGGG + Intergenic
1159378032 18:67619592-67619614 GCACTTTGGGAGGTAGAAACAGG - Intergenic
1159993883 18:74942674-74942696 GCACCAAGGCAGACAGACTCAGG - Intronic
1160986163 19:1839925-1839947 GGCCCTAGGGAGACAGGATCTGG - Intronic
1162255457 19:9485780-9485802 GTACTTTGGGAGATAGAAGCGGG - Intronic
1162274629 19:9643103-9643125 GCACTTTGGGAGGTTGAATCAGG + Intronic
1162733326 19:12731874-12731896 GCACTTTGGGAGGTAGAATCGGG + Intronic
1162936725 19:13985106-13985128 GCACTTCGGGAGATGGAAGCAGG - Intronic
1163715260 19:18869387-18869409 GCACCTGGGGAGGTAGGAACAGG + Exonic
1165337173 19:35179239-35179261 GCATCTAGGGAAAAAGATTCTGG - Intergenic
1166163932 19:40973041-40973063 GCACCAAAGGAGAGAGAACCTGG + Intergenic
1166705762 19:44907127-44907149 GCACTTTGGGAGATCGAAACGGG - Intronic
926524956 2:13968586-13968608 GCACTTTGGGAGATGGAAGCGGG - Intergenic
926909388 2:17836484-17836506 GCACTTAGGGAGACAGAGGCGGG - Intergenic
927026995 2:19078547-19078569 GCACCTCAGCAGATAAAATCAGG - Intergenic
927785866 2:25974445-25974467 GCACTTTGGGAGACAGAAGCAGG - Intronic
930023294 2:47014358-47014380 CCACCTAGGGAGCAAGAATTAGG - Intronic
931589776 2:63870166-63870188 GCACTTTGGGAGACAGAGTCAGG - Intronic
932066366 2:68566389-68566411 GCCCCTAAGGAGACAGAGTCTGG - Intronic
938604043 2:132873980-132874002 GCCTCCAGGGCGATAGAATCTGG + Intronic
938675309 2:133627526-133627548 GCACCTGGGGAGATCGAGGCAGG + Intergenic
938741253 2:134234605-134234627 GCACCTGGTGAGAGAGAAGCAGG - Intronic
940383066 2:153038254-153038276 AAACCTAGGGGGAAAGAATCAGG - Intergenic
941795813 2:169597251-169597273 GCATCTAGGGAGAGAGAAAATGG - Intronic
945414810 2:209557817-209557839 GCACTGAGGGAGTTAGAATTCGG + Intronic
945661056 2:212685873-212685895 GCACCTTGGGAGACTGAAGCAGG - Intergenic
946044191 2:216807556-216807578 GCACCTTGGGAGACCGAAGCAGG - Intergenic
1171518735 20:25759656-25759678 GCACCCTGGGAGATGGCATCGGG + Intergenic
1171853905 20:30327636-30327658 GCACTTTGGGAGATAGGAGCAGG + Intergenic
1172789898 20:37495858-37495880 GCACCTAGGCAGAAAGAAAGGGG + Intronic
1173383252 20:42565278-42565300 GCACCTAGGCGGACAGAAGCAGG - Intronic
1177603702 21:23351196-23351218 GCACTTTGGGAGAGAGAACCAGG + Intergenic
1180654028 22:17404011-17404033 GCACTTTGGGAGATGGAGTCAGG + Intronic
1181880089 22:25972030-25972052 GCACTTTGGGAGATAGAGGCAGG - Intronic
1182719746 22:32387460-32387482 GCACCCAGGGAGTTGTAATCAGG - Intergenic
1183435684 22:37793298-37793320 GCACTTTGGGAGATAGAGGCGGG + Intergenic
1183806243 22:40213602-40213624 GCATCAAGGGAGACATAATCAGG + Intronic
949511725 3:4772294-4772316 GCACAGAGGGAGAAGGAATCTGG + Intronic
951779868 3:26350310-26350332 GCACTTAGGGAGACAGAGGCAGG - Intergenic
955367782 3:58326397-58326419 GCACCTTGGGAGACAGAGACGGG - Intergenic
956102214 3:65780268-65780290 GCACTTTGGGAGATTGAAGCGGG - Intronic
956680838 3:71779068-71779090 GGAACTAGGGAAATAGAATTCGG + Intronic
956824166 3:72982334-72982356 GCACCTTGGGAGATTGAGGCAGG + Intronic
956839557 3:73125057-73125079 GCACCTAGGGTGATGGGCTCTGG + Intergenic
961220631 3:125196680-125196702 GCACTTTGGGAGACAGAAGCTGG + Intronic
961369915 3:126422888-126422910 GCACCTAGAGAGATGGGACCTGG + Intronic
964172712 3:153789936-153789958 AAACCTAGGGAGAAGGAATCAGG - Intergenic
967485402 3:190024290-190024312 GCACTTTGGGAGATAGAGGCAGG + Intronic
968819861 4:2842798-2842820 GCACTTAGGGAGGCAGAAACAGG - Intergenic
969207766 4:5660507-5660529 GGACCCAGGGAGATAGGATCAGG + Intronic
969225763 4:5797317-5797339 GCACCAAGGGTGATAGGATTCGG - Intronic
970115475 4:12690221-12690243 GCACCTAGGGGCATTGAAGCTGG - Intergenic
970927727 4:21472317-21472339 GCAAATAGGGGGATAGAACCTGG + Intronic
975136560 4:70880106-70880128 GCACTTAGGGAGACAGAGGCAGG - Intergenic
977521780 4:98094053-98094075 GGACCTAGGGAGATACCAGCTGG + Intronic
978397648 4:108298963-108298985 GCACTTTGGGAGGTGGAATCAGG - Intergenic
978533121 4:109733921-109733943 GCACCTAGGGAGATCAAGGCTGG + Intergenic
979181462 4:117734311-117734333 GCACTTTGGGAGATAGAGGCAGG + Intergenic
981428550 4:144633493-144633515 GCACTTTGGGAGACAGAAGCAGG + Intergenic
986111575 5:4724200-4724222 GCAGTTAGGGAGATAGACCCTGG - Intergenic
990877298 5:60500060-60500082 GCACTTAGGGAGATTGAAACAGG + Intronic
992121596 5:73599132-73599154 GCACTTTGGGAGATAGAGGCAGG - Intergenic
992698914 5:79319824-79319846 GCACTTAGGGAGGCAGAAGCAGG - Intronic
993277793 5:85883653-85883675 GCTACTAGGGAGATAGAGGCAGG + Intergenic
994310146 5:98259812-98259834 TGACCTAGGGAGATACCATCTGG - Intergenic
994780677 5:104086217-104086239 GCAACTAGGGAGCTAGAATAAGG - Intergenic
994802366 5:104395391-104395413 GAACTTAAGGAGATAGAAACAGG - Intergenic
997245162 5:132341699-132341721 GCACTTAGGGAGATTGAGGCAGG + Intronic
998261299 5:140633682-140633704 GCACCAAGGGGGGTAGAATTAGG + Exonic
999286288 5:150396263-150396285 CCACCTATGGAGAGAGAATGTGG - Exonic
999312455 5:150560326-150560348 GCTCCTATGGAGTTAGGATCTGG + Intergenic
1002710867 5:181194290-181194312 GCTCTTAGGGAGATGGAAACTGG + Exonic
1002992546 6:2251120-2251142 GCACTTTGGGAGATAAAGTCTGG + Intergenic
1003019857 6:2500407-2500429 GCACTTTGGAAGATAGAAGCTGG - Intergenic
1004726536 6:18316375-18316397 GCACTTTGGGAGATAGAGGCAGG - Intergenic
1005744290 6:28821956-28821978 GCACGTAGGGAGGCAGAAGCGGG + Intergenic
1009768723 6:68117786-68117808 GCAGATAGTGAGATAAAATCTGG + Intergenic
1014766852 6:125416878-125416900 GCACTTTGGGAGATAGAGGCAGG + Intergenic
1014964195 6:127726287-127726309 GCAACTAGGGAAATAGATTCAGG - Intronic
1016721896 6:147307920-147307942 GCACCCAGGGAGATCAAACCGGG - Intronic
1018024452 6:159793071-159793093 GCACCTTGGGAGGCTGAATCAGG - Intronic
1019832495 7:3346915-3346937 GCACTTTGGGAGGCAGAATCAGG - Intronic
1020537482 7:9419378-9419400 GCACTTTGGGAGGTTGAATCGGG + Intergenic
1020742501 7:12039547-12039569 GCTACTTGGGAGATAGAGTCAGG + Intergenic
1025279227 7:57614786-57614808 GCACCCTGGGAGATGGCATCGGG + Intergenic
1025305504 7:57850714-57850736 GCACCCTGGGAGATGGCATCGGG - Intergenic
1026743297 7:72992109-72992131 GCACTTTGGGAGATAGAGGCAGG - Intergenic
1026782784 7:73281169-73281191 GCACTTTGGGAGATAGAGGCAGG - Intergenic
1027029410 7:74876806-74876828 GCACTTTGGGAGATAGAGGCAGG - Intergenic
1027100438 7:75372969-75372991 GCACTTTGGGAGATAGAGGCAGG + Intergenic
1027125016 7:75550334-75550356 GGAGTAAGGGAGATAGAATCAGG - Intronic
1027387288 7:77671264-77671286 GCACCTTGGGAGACTGAAGCGGG - Intergenic
1029092237 7:98057301-98057323 GCACTTAGGGAGACAGAGGCAGG + Intergenic
1030027150 7:105335411-105335433 GCACTTTGGGAGACAGAAGCAGG + Intronic
1031783743 7:126002683-126002705 GCCCCTAGGGACACAGTATCTGG - Intergenic
1031817519 7:126456361-126456383 GGGACTAGGGAGATAAAATCTGG + Intronic
1031917167 7:127574552-127574574 GCACTTAGGGAGGTAGAGCCGGG - Intergenic
1033148987 7:138896845-138896867 GCACTTTGGGAGATAGAGGCAGG - Intronic
1033629468 7:143142407-143142429 GCACTTTGGGAGGTAGAAGCAGG - Intergenic
1034200471 7:149280487-149280509 GTCCCCAGGGAGATAGAAGCTGG - Intronic
1034349621 7:150407565-150407587 GTCCCTAGGGAGACAGAAGCGGG - Intronic
1034788049 7:153943244-153943266 GCAGCTAGGGAGATATTTTCGGG + Intronic
1036571890 8:9986953-9986975 GCACTTTGGGAGATTGAAGCAGG + Intergenic
1039825022 8:41165765-41165787 GCACTTTGGGAGACAGAAGCGGG - Intergenic
1043834934 8:85035070-85035092 GCACTTAGGGAGGCAGAAGCAGG - Intergenic
1044286436 8:90416046-90416068 GCTACTAGGGAGACAGAAGCAGG + Intergenic
1046633339 8:116644141-116644163 GCACTTTGGGAGACAGAAGCAGG + Exonic
1048228177 8:132611004-132611026 GCTCCTCGGGAGATTGAAGCAGG - Intronic
1048571920 8:135663570-135663592 GCACCTAGGGAGGCAGATGCAGG - Intergenic
1048703925 8:137128467-137128489 GCACTTTGGGAGATTGAAGCAGG + Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049158377 8:141081438-141081460 GCACCTAGGGAGGCAGAGGCAGG - Intergenic
1050749766 9:8923286-8923308 GCACTTAGGGAGGCAGAAGCAGG - Intronic
1052030460 9:23622334-23622356 GCACGTAAGGAGAAAGAAGCTGG + Intergenic
1056451746 9:86723358-86723380 GCACCAAGGGAGAGAGACTGGGG - Intergenic
1057698636 9:97346821-97346843 GCACTTTGGGAGATGGAAGCAGG - Intronic
1059002044 9:110358518-110358540 GCACCCATGGACATAGAATGTGG - Intergenic
1187382685 X:18819434-18819456 GCACCTTGGGAGATTGAGGCGGG + Intronic
1192323498 X:70112142-70112164 GCACCTTGGGAGTTGGAAGCAGG - Intergenic
1197413744 X:126150200-126150222 GCACCCAGGCAAATAGGATCTGG - Intergenic
1197444494 X:126533567-126533589 GCAGGCAAGGAGATAGAATCAGG + Intergenic
1198327789 X:135591422-135591444 GCACTTTGGGAGATAGAGGCAGG + Intergenic
1199783672 X:151084787-151084809 GGACCAAGGGAGATAGCCTCAGG - Intergenic
1201619400 Y:15938957-15938979 GCACTTTGGGAGGTAGAATTGGG - Intergenic
1202050145 Y:20772284-20772306 GCACTTTGGGAGACAGAAGCAGG - Intronic