ID: 1149523764

View in Genome Browser
Species Human (GRCh38)
Location 17:57338542-57338564
Sequence GGATGCAACAAGTCTGCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149523764_1149523772 0 Left 1149523764 17:57338542-57338564 CCCCACGCAGACTTGTTGCATCC 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1149523772 17:57338565-57338587 CAGTTGCTTGGGGACCCTGAAGG 0: 1
1: 0
2: 0
3: 14
4: 158
1149523764_1149523769 -10 Left 1149523764 17:57338542-57338564 CCCCACGCAGACTTGTTGCATCC 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1149523769 17:57338555-57338577 TGTTGCATCCCAGTTGCTTGGGG 0: 1
1: 0
2: 1
3: 8
4: 117
1149523764_1149523775 19 Left 1149523764 17:57338542-57338564 CCCCACGCAGACTTGTTGCATCC 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1149523775 17:57338584-57338606 AAGGCTGCATAACTCGTAGCCGG 0: 1
1: 0
2: 0
3: 7
4: 140
1149523764_1149523776 20 Left 1149523764 17:57338542-57338564 CCCCACGCAGACTTGTTGCATCC 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1149523776 17:57338585-57338607 AGGCTGCATAACTCGTAGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149523764 Original CRISPR GGATGCAACAAGTCTGCGTG GGG (reversed) Intronic
902634824 1:17728433-17728455 GGATGCAGGAAGACTGCTTGAGG - Intergenic
903845856 1:26279753-26279775 GGATGCACCAAACCTGTGTGCGG + Exonic
907648467 1:56268511-56268533 TGATGCAGAAAGTCTGTGTGGGG + Intergenic
908089170 1:60668698-60668720 AGATGCTACAAGTCTGCTCGCGG - Intergenic
915640568 1:157221024-157221046 TGATGCAATAGGTCTGGGTGAGG + Intergenic
919752659 1:201047949-201047971 AGCTGCAGCAAGTCTGCCTGGGG - Intronic
921575526 1:216830630-216830652 GGGTGAAAAAAGTCTGAGTGAGG - Intronic
1066227131 10:33394233-33394255 GGACATAACAAGTCTGCGTTGGG + Intergenic
1074668493 10:115759143-115759165 GGATGCAGGAAGTCTGGGTTAGG + Intronic
1076743607 10:132500834-132500856 GGACCCAGCAAGTCTGCGTCTGG + Intergenic
1077252316 11:1566110-1566132 GGATGCAACAAGGCAGAGGGGGG + Intronic
1084197669 11:67533597-67533619 GGATCCAACAGCTCTGAGTGGGG - Intergenic
1084444939 11:69198104-69198126 GGATTCAATAAGTCTGGATGAGG + Intergenic
1088276074 11:108087254-108087276 GGATGCATCAACTCTTAGTGGGG - Intronic
1090140609 11:124256107-124256129 TGATCCAGCAAGTCTGAGTGCGG - Intergenic
1096245149 12:49980601-49980623 GGAGGTAAGAAGTCTGGGTGGGG + Intronic
1102584770 12:113915184-113915206 GGATTCAAGGAGTGTGCGTGGGG + Intronic
1103334004 12:120175644-120175666 TGATGCTCCAAGTCTGCCTGTGG - Intronic
1104472673 12:129043258-129043280 GGAGGCAACAAGGCTGGGGGAGG - Intergenic
1107077259 13:36336315-36336337 GGAAGCAACAGGGCTGTGTGGGG - Intronic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1113583253 13:111444140-111444162 GGATCCAACAATTCTGCTTCTGG - Intergenic
1115634533 14:35278726-35278748 TCAAGCAACAAGTCTGAGTGAGG - Intronic
1117080921 14:52151033-52151055 GGATGCAACAAGGCAGCAGGGGG - Intergenic
1119731826 14:76956208-76956230 GGAGGGAAGAAGTCTGCCTGGGG + Intergenic
1121714520 14:96063597-96063619 GGATGCCACATGGCTGGGTGTGG - Intronic
1130053100 15:80500142-80500164 GGATCCAACCAGTGTGCCTGAGG - Intronic
1134374792 16:13661910-13661932 GGATCCTACAAGCCTGAGTGAGG + Intergenic
1136550775 16:30981214-30981236 TGATGCAACAAGACAGCATGGGG + Intronic
1137306192 16:47202976-47202998 TGATGCAGCAAGTCTGCTTTTGG + Intronic
1140117097 16:72051382-72051404 GGATCCAACAGGTGTGTGTGGGG - Intronic
1146766131 17:35523511-35523533 TGATGCAACAATTCTGCTTCAGG - Intronic
1149314579 17:55426747-55426769 GCATTCAAAAAATCTGCGTGGGG - Intergenic
1149523764 17:57338542-57338564 GGATGCAACAAGTCTGCGTGGGG - Intronic
1152085098 17:78213272-78213294 GGAGGCACCAGGCCTGCGTGGGG + Intergenic
1157588360 18:48819621-48819643 GCATCCAACAAGTGTGCGTTAGG - Intronic
1158881678 18:61784761-61784783 GTATCCATCAAGTCTGAGTGAGG - Intergenic
926364376 2:12119786-12119808 GAATGCAGCAGGTCTGGGTGTGG - Intergenic
928694403 2:33834471-33834493 GGAGGCAAAAAGTCTTCTTGGGG + Intergenic
947975396 2:234361633-234361655 AGATGCATGTAGTCTGCGTGTGG + Intergenic
1168844205 20:932287-932309 GGATCCAACAACTCTGAGTGGGG + Intergenic
1170853785 20:20029324-20029346 GGAAGTAACAAGTCTGGGAGTGG + Intronic
1174646144 20:52087457-52087479 GGATGCAACATTTCTGCCAGTGG + Intronic
1175474046 20:59256724-59256746 GCATGCAAGAAGTTTGGGTGGGG + Exonic
1179490831 21:41740752-41740774 GGATGGAACGATCCTGCGTGGGG - Exonic
1180664550 22:17499415-17499437 GGATGCAGACAGTCTCCGTGTGG + Exonic
949492988 3:4607218-4607240 TGATGCAGCAAGTCTGGGTGGGG - Intronic
949521556 3:4859682-4859704 GGATATAACAAGTGTTCGTGGGG + Intronic
950883233 3:16340109-16340131 GGAAGAAACAAGTTTGTGTGTGG - Intronic
951520452 3:23606321-23606343 GTATGCAACAGTTCTGCGGGAGG + Intergenic
955774731 3:62421073-62421095 GGAGGTAAGAAGTCTGCGTCAGG + Intronic
956195981 3:66653263-66653285 GAAGGCACCAAGTCTGTGTGTGG + Intergenic
965739000 3:171853039-171853061 GGAAGCAACTAGTCTGGGTTGGG - Intronic
967924723 3:194637246-194637268 GGATGACACAAGACTGGGTGGGG - Intergenic
969241898 4:5904445-5904467 GGAAGCAAGAAGGCTGGGTGTGG + Intronic
970967796 4:21948545-21948567 GGATGCAATAAGCTTGCGAGCGG - Intronic
972532149 4:39971062-39971084 GAATGGAACAAGGCTGGGTGTGG - Intronic
976829589 4:89299380-89299402 GTATGCAGCAAGTGTGCATGAGG + Intronic
977004833 4:91552647-91552669 GGAAGCAACAAGGCTGACTGTGG + Intronic
978143828 4:105348567-105348589 GGATGCATCAAGTCTCACTGAGG - Intergenic
978236263 4:106464735-106464757 GGAGGCAAAAAGTTTGCCTGGGG + Intergenic
979726984 4:123974010-123974032 TGATTCAGCAAGTCTGAGTGGGG + Intergenic
980081929 4:128353376-128353398 GGATGAAACTAGGCTGGGTGTGG + Intergenic
982820168 4:159934779-159934801 GGAGGCAACAAGGCTGGGGGAGG - Intergenic
990580926 5:57167002-57167024 GCATGTAGCAAGTCTGGGTGTGG + Intergenic
997827956 5:137124410-137124432 GGAGGCAACAGGGCTGCCTGAGG - Intronic
1004080157 6:12384190-12384212 GGAGGCAACAAGCCTCCATGCGG - Intergenic
1012605960 6:101157831-101157853 GGCGGCAGCAAGGCTGCGTGAGG - Intergenic
1028988710 7:97027233-97027255 GAATGGCTCAAGTCTGCGTGAGG - Intergenic
1029955375 7:104633425-104633447 GGATTAAACAAGTCTACCTGGGG + Intronic
1031954168 7:127925053-127925075 TGATGCAACAAATGTGCCTGGGG - Intronic
1035786717 8:2266823-2266845 GGATTCAGCAAGTTTGGGTGGGG + Intergenic
1035806090 8:2454893-2454915 GGATTCAGCAAGTTTGGGTGGGG - Intergenic
1036727010 8:11229516-11229538 GGAAGCAGCAAGTCTGCAGGGGG - Intergenic
1038417009 8:27404499-27404521 GGATGCATCCAGACTGGGTGGGG - Intronic
1044013483 8:87023251-87023273 GGATTCATCAAGTCTGCTTTAGG - Intronic
1049467035 8:142756274-142756296 GGATGGAACATGTCTGCCAGTGG - Intergenic
1060780429 9:126408410-126408432 GGATCCATCAGGCCTGCGTGGGG - Intronic
1186075474 X:5874022-5874044 GAATGCAACAAGGCTGCATTTGG + Intronic
1196822733 X:119715140-119715162 GGATGAAACTAGGCTGGGTGCGG + Intergenic
1196882937 X:120215557-120215579 GAATGTAACAAGGCTGGGTGTGG + Intergenic