ID: 1149526163

View in Genome Browser
Species Human (GRCh38)
Location 17:57357432-57357454
Sequence GCTGCCGAATGAAGCTCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 65}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149526163_1149526172 30 Left 1149526163 17:57357432-57357454 CCACTTGAGCTTCATTCGGCAGC 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1149526172 17:57357485-57357507 CCCCAGACCTTGTGCTTTCTTGG 0: 1
1: 0
2: 2
3: 37
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149526163 Original CRISPR GCTGCCGAATGAAGCTCAAG TGG (reversed) Intronic
904112381 1:28136314-28136336 GCAGCCAAAAGAAGCTCAGGAGG - Intergenic
905307584 1:37030202-37030224 GCAGCTGAATGAAGATCAATAGG - Intronic
909878097 1:80836547-80836569 GCTGACATATGAAGCTCCAGTGG - Intergenic
916358191 1:163936741-163936763 GCTGCCTACAGAAGCTCTAGGGG + Intergenic
924044285 1:240011708-240011730 GCTTCCAAATGAAGCTCTCGAGG + Intergenic
924377490 1:243428226-243428248 CGTGCCGAATGAAGGTCAGGTGG + Intronic
1062935242 10:1380618-1380640 GCTCCCGAATGAATTTCAATGGG - Intronic
1079381266 11:19939689-19939711 ACTGCCGAGTCAAGCTCAACAGG + Exonic
1079407769 11:20160571-20160593 TCCGGCGAATGAAGCTCGAGTGG - Exonic
1101713356 12:107289017-107289039 GTTGCCGAATGAAGGACAGGCGG - Intergenic
1106696376 13:32178320-32178342 CCTGCCGGAGGAAGCTGAAGAGG - Exonic
1111476073 13:88749601-88749623 GCTGTGGAATGAAGCAAAAGAGG + Intergenic
1112771423 13:102798960-102798982 GCTCCCAAATGATGCTCCAGTGG - Exonic
1116676226 14:47909375-47909397 GATTCAGAATGAAGCTTAAGAGG - Intergenic
1123027351 14:105432954-105432976 GCTTTCGACTGAAGCTCAGGCGG - Intronic
1124893710 15:33756910-33756932 GCAGCTGGATGAAGCTCAAATGG - Intronic
1127750401 15:62034664-62034686 TCTGCCTAATGCAGCTCAACAGG + Intronic
1133352731 16:5112919-5112941 GGCGCGGACTGAAGCTCAAGGGG - Intergenic
1143897009 17:10144282-10144304 GCTGCCGAAAGACGCCCAGGAGG + Intronic
1147944250 17:44071316-44071338 GCTGCACAAAGATGCTCAAGGGG - Intronic
1149526163 17:57357432-57357454 GCTGCCGAATGAAGCTCAAGTGG - Intronic
1152148921 17:78586842-78586864 GCTGCAGTTTGAGGCTCAAGGGG - Intergenic
1159115771 18:64111441-64111463 GCTTCTGAATGCAGCTCAAATGG + Intergenic
1159273734 18:66188460-66188482 GCTGCAGTATAAAGTTCAAGAGG + Intergenic
1161795390 19:6383455-6383477 GCTGCTGCATGATGCTGAAGTGG + Exonic
1163212613 19:15852330-15852352 TCTGCCACCTGAAGCTCAAGAGG + Intergenic
1164657836 19:29937723-29937745 GCTGCCATAGGAAGCACAAGAGG + Intronic
929284700 2:40122287-40122309 GCTTCCAAGTGAAGTTCAAGAGG + Intronic
933620955 2:84540800-84540822 GCTGTTCAATGAAGATCAAGGGG - Intronic
934654608 2:96110644-96110666 GCTGCAGAATGCAGTTAAAGAGG - Intergenic
941606028 2:167597521-167597543 GCTGCCAACTGACACTCAAGAGG + Intergenic
943117746 2:183693899-183693921 GCTGCCCAAGGAAGTTCAGGTGG - Intergenic
944795401 2:203179256-203179278 GTAGCTGAATGAAGCTCAAATGG - Intronic
1169450866 20:5709785-5709807 GCTGTTGAGAGAAGCTCAAGGGG + Intergenic
1183970999 22:41477457-41477479 GCTGCAGAATAAAACTAAAGAGG - Intronic
1184546587 22:45173740-45173762 GCAACCGAAGGAAGTTCAAGAGG + Intronic
951718040 3:25669966-25669988 GCTGAAGAATGAATCTCAAATGG - Intergenic
959620471 3:108394084-108394106 GATGCAGAAAGAAGCTGAAGAGG - Exonic
967558670 3:190892591-190892613 TCTGCTGAATGAAACTCAACTGG - Intergenic
967598641 3:191357994-191358016 GATGCCAAATGATGCTCAACTGG - Exonic
976019538 4:80604482-80604504 GCTGACAATTGAAACTCAAGAGG + Intronic
979665312 4:123304548-123304570 GCAGCCCAATTAAGCTCAACAGG + Intronic
995047395 5:107668720-107668742 GCTGCCTAATAAAGCACAAACGG + Intronic
995747037 5:115414976-115414998 GCTCACTAATGCAGCTCAAGTGG - Intergenic
998040477 5:138948203-138948225 GCTGCCGCAGGAAGCACAGGTGG - Intronic
998536479 5:142936362-142936384 GCTGCTGAAAGAAACTAAAGAGG + Intronic
1005888048 6:30112261-30112283 GCTGCCCACTCAAGCCCAAGGGG + Intronic
1008122415 6:47633693-47633715 GCTTCCAAAGGAAGCTCTAGGGG + Intergenic
1008379369 6:50824310-50824332 GCTTCAGAATGAAGTTCCAGGGG + Intronic
1010784958 6:79990374-79990396 GCTGTAAAATGTAGCTCAAGAGG + Intergenic
1017235928 6:152117691-152117713 GCAGCCGAAGGAAGCTAAGGGGG - Intronic
1022156007 7:27662654-27662676 GCGGCCGAAAGAAGGACAAGGGG + Intronic
1024310591 7:47965719-47965741 GCTGCAGAAGGATGCTCATGTGG - Intronic
1030939391 7:115627607-115627629 GCAGCTGAATGAAGCTCACCAGG - Intergenic
1036377707 8:8214786-8214808 GGCGCGGACTGAAGCTCAAGGGG + Intergenic
1036851856 8:12208363-12208385 GGCGCGGACTGAAGCTCAAGGGG - Intergenic
1036873222 8:12450881-12450903 GGCGCGGACTGAAGCTCAAGGGG - Intergenic
1041055445 8:53981089-53981111 GCTGCCGAAGAAAAGTCAAGAGG + Intronic
1042359894 8:67870454-67870476 GCTGCAGAATGAAGCTGGACAGG + Intergenic
1043342208 8:79253761-79253783 GCTGCTGCATGAAGGCCAAGAGG + Intergenic
1056553123 9:87667317-87667339 GCTGCCGGTTGAAGCCCAGGTGG - Intronic
1060433020 9:123566684-123566706 TCTGCCAAATAAAGCTCAGGAGG + Intronic
1060436558 9:123598081-123598103 CCTGCCGAGTGAAGATCAAAGGG - Intronic
1185530806 X:816907-816929 GCTGCTGAATTATTCTCAAGCGG + Intergenic
1186076862 X:5889637-5889659 TCTACCGAATGAAACTCAAGAGG - Intronic
1186944359 X:14548899-14548921 GCTGGAAGATGAAGCTCAAGAGG - Intronic
1190059790 X:47203267-47203289 GATGCCGAAGGAAGCCCCAGGGG - Intronic