ID: 1149531190

View in Genome Browser
Species Human (GRCh38)
Location 17:57396770-57396792
Sequence CTGTGTGCACAAAGGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149531190_1149531195 9 Left 1149531190 17:57396770-57396792 CCCACTGCCCTTTGTGCACACAG 0: 1
1: 0
2: 1
3: 24
4: 227
Right 1149531195 17:57396802-57396824 CACACACGCACACATGCACACGG 0: 2
1: 15
2: 123
3: 2314
4: 3553

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149531190 Original CRISPR CTGTGTGCACAAAGGGCAGT GGG (reversed) Intronic
900418092 1:2544152-2544174 CTGTGTGCACACGGCCCAGTGGG + Intergenic
900596725 1:3483359-3483381 CTGTGTGGATGCAGGGCAGTGGG + Intergenic
901594643 1:10375271-10375293 CTGTCTGCACAAAGCACCGTGGG + Exonic
902368081 1:15990298-15990320 CTGTGGGTACCAAGGGCAGCTGG - Intergenic
902648704 1:17822712-17822734 ATGTGTGTGCAAAGTGCAGTGGG + Intronic
903985264 1:27222886-27222908 CTGTGTCCTCACATGGCAGTAGG + Intergenic
905403317 1:37718010-37718032 CAGTGGGTACAAATGGCAGTAGG + Exonic
906692500 1:47801822-47801844 CTGTGTGGGCAAAGGGCTGGAGG - Intronic
910154157 1:84194117-84194139 CTGCTTGAACAAGGGGCAGTAGG - Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
915822219 1:159036828-159036850 CTGTGTGGTCACAGTGCAGTTGG - Intronic
916480917 1:165213583-165213605 CTGAGTGCACACAGAGAAGTGGG + Intronic
918334219 1:183491909-183491931 CTGTGTCCACATATGGCAGAAGG + Intronic
919976062 1:202613705-202613727 CTGTCTGCAGAAAGGGGAGGAGG - Intronic
921882821 1:220273639-220273661 ATGTGAGCACAAAGGCCTGTAGG + Intergenic
923800550 1:237204987-237205009 CTGTGTCCTCTCAGGGCAGTGGG - Intronic
924384774 1:243490664-243490686 CTGTGTGCCCAAGGGCCCGTGGG - Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063426131 10:5951443-5951465 CTGGCTGTACAAGGGGCAGTTGG + Intronic
1067564461 10:47326673-47326695 CTGTGTGCACCACTGGCCGTGGG - Intergenic
1069847074 10:71379818-71379840 CAGTGTCCACAAAGTGCACTCGG - Intergenic
1070148544 10:73791836-73791858 CTGTGGGAACAAGGGGCAGGAGG - Intronic
1070299730 10:75194436-75194458 CTGTATGAACAGAGGACAGTGGG - Intergenic
1070398602 10:76033685-76033707 CTTTGTGCACAAACATCAGTTGG - Intronic
1071146643 10:82582356-82582378 CTGTTTTCACAAAGGGCAGGGGG + Intronic
1072630087 10:97139799-97139821 CAGTGTGCACACAGGGCACTGGG + Intronic
1074164782 10:110865534-110865556 CTATGTGCACTCAGGGCAGCTGG + Intergenic
1076521668 10:131085111-131085133 CTGTGTCCCCACAGGGCAGAGGG - Intergenic
1077571308 11:3340513-3340535 CTGTGGGCACAAAGGTCTCTGGG + Intronic
1079236341 11:18693376-18693398 CTGTAAGCAGAAAGGGCAGAAGG + Intronic
1079469481 11:20764755-20764777 CTGTGTTCACAAAAGGCTGAGGG + Intronic
1079904223 11:26224543-26224565 CAGTGTGCACACAGGGCATAAGG - Intergenic
1080738500 11:35041162-35041184 ATGTGTGCTTAAAGGGAAGTGGG + Intergenic
1081800996 11:45859238-45859260 CTGTGTGAACAGAGGTCTGTTGG - Intronic
1083365824 11:62140924-62140946 CTGTGTGCAGAAAGGTCCGGAGG - Exonic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085134000 11:74068445-74068467 ATCTGTAGACAAAGGGCAGTGGG - Intronic
1085527941 11:77174923-77174945 CTGAGTGCACAGAGGGCAGGAGG + Intronic
1085765714 11:79279986-79280008 CTGTGTCCTCAAATGGCAGAGGG - Intronic
1088357837 11:108961709-108961731 CCGTGGGCACACAGGGCAGAAGG + Intergenic
1089117721 11:116109576-116109598 GGGTGTGCACAAATGGCAGAAGG + Intergenic
1089192210 11:116661231-116661253 CTGTGTGCAGAGTGGGCTGTGGG - Intergenic
1089194576 11:116686788-116686810 CTGTGTGGTCCAGGGGCAGTTGG + Intergenic
1090883117 11:130852029-130852051 CTGTGAGCACGAAGGGGAGCAGG + Intergenic
1091171793 11:133526254-133526276 CTGTGGGCACACATGGCAGGAGG - Intronic
1091668230 12:2434572-2434594 CTGCATGCACGAAGGGGAGTGGG + Intronic
1091769958 12:3145103-3145125 CTGTGTGCTCACAAGGGAGTGGG - Intronic
1096727507 12:53576533-53576555 CTGTGTCCTCACATGGCAGTTGG - Intronic
1097325553 12:58272418-58272440 CTGTGTCCTCACATGGCAGTAGG + Intergenic
1097893253 12:64799727-64799749 TTGTGTGTACAAAGGGCAATAGG + Intronic
1098590698 12:72208175-72208197 GTGTGTGTATAAAGGGCAGAGGG - Intronic
1099627168 12:85090002-85090024 CTGTGGCCACACAGGGCAGTGGG - Intronic
1101646012 12:106631587-106631609 CTGTGTTCACACATGGCAGAAGG - Intronic
1102108877 12:110349086-110349108 CTGTCTGGACCAAGGGAAGTGGG - Intronic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1103993551 12:124814890-124814912 CTCTCTGCACAAGGGGCAGGCGG + Intronic
1106753000 13:32794231-32794253 CTGTGTGGAGAAAGGGCTCTGGG - Intergenic
1107239794 13:38218740-38218762 CTGTGTCCTCACAGGGCAGTAGG + Intergenic
1108987224 13:56607789-56607811 TTGTGTAGACAAAAGGCAGTGGG - Intergenic
1109922883 13:69092574-69092596 CTCTGAGCACAAATGCCAGTAGG + Intergenic
1110076810 13:71256238-71256260 CTGTGTGCTCACATGGCAGAAGG + Intergenic
1111600946 13:90473223-90473245 AAGAGTTCACAAAGGGCAGTTGG - Intergenic
1111830762 13:93326074-93326096 CTGAGTGCACTCAGGGCACTAGG - Intronic
1113630097 13:111876424-111876446 CGGTGCACACAGAGGGCAGTGGG + Intergenic
1113653041 13:112050816-112050838 CTGTTCCCACAAAGGGCAGTTGG + Intergenic
1113874048 13:113583656-113583678 GTGTGTGCACATGGGGCAGCAGG - Intergenic
1114250008 14:20951228-20951250 CTGTGTGCTCAAAATGCAATGGG + Intergenic
1114614092 14:24059247-24059269 CTGTGTGGGCAAGGGGCGGTTGG - Intronic
1114746598 14:25154966-25154988 CTGTGTGGAGTAATGGCAGTGGG + Intergenic
1116811498 14:49543965-49543987 CTGTGTGAATAAAGGGCGTTGGG + Intergenic
1120176708 14:81302019-81302041 CACTGTGCACTGAGGGCAGTTGG + Intronic
1120650419 14:87125349-87125371 ATGTGTGCATAAAAGACAGTAGG - Intergenic
1121087620 14:91158367-91158389 CTGTGGGAACAAAGTGCTGTGGG - Intronic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1121721195 14:96109769-96109791 CTGTGTGCACATAGTGCACCGGG + Intergenic
1122033498 14:98931074-98931096 CTGTGTGCACAGAAGACAGGTGG - Intergenic
1122419998 14:101569929-101569951 CTCTGTGTACACAGGGGAGTGGG - Intergenic
1124491706 15:30162033-30162055 CTGTCTGCAGAAAGGGGAGGAGG - Intergenic
1124751830 15:32376276-32376298 CTGTCTGCAGAAAGGGGAGGAGG + Intergenic
1126117911 15:45225739-45225761 CTGTGTCCTCAAAGGGCAGAGGG + Intergenic
1127672581 15:61210056-61210078 CTGTGTGTACAGGGGCCAGTTGG + Intronic
1129226410 15:74172957-74172979 CTGGGTGCCCAGTGGGCAGTGGG + Intergenic
1130321455 15:82846017-82846039 GACTGTGCACAGAGGGCAGTTGG - Intronic
1131227604 15:90638466-90638488 CTGTGGGCAGAAAGGAAAGTTGG - Exonic
1133130425 16:3673299-3673321 CTGTGTGCTCAGAGGGCAGCAGG + Intronic
1134144831 16:11752367-11752389 CTGTGAACACAAAGGTCATTTGG + Intronic
1134310229 16:13069848-13069870 CTGTGTCCTCACAGGGCAGAAGG - Intronic
1134847872 16:17456097-17456119 CTGTGTGCACAGAGTGAAGCTGG - Intronic
1136220733 16:28826423-28826445 CTGTGTGCATAGAGGACAGAGGG + Intronic
1139850780 16:69950749-69950771 CTGTGGGCTCAAAGGGGGGTGGG - Intronic
1139879764 16:70173661-70173683 CTGTGGGCTCAAAGGGGGGTGGG - Intronic
1140372760 16:74421887-74421909 CTGTGGGCTCAAAGGGGGGTGGG + Intronic
1141624430 16:85253821-85253843 CTGTGTGTGCAAAGGCCAGGAGG + Intergenic
1141624447 16:85253893-85253915 CTGTGTGTGCAAAGGGCAGGAGG + Intergenic
1141850727 16:86644034-86644056 CATTCTACACAAAGGGCAGTGGG - Intergenic
1141963663 16:87426470-87426492 CTGTGTGCACATTGGGCTTTGGG - Intronic
1143205193 17:5136254-5136276 TTGTGGGCACCAAGGGCAGCAGG - Intronic
1143405581 17:6675229-6675251 CCGTGTGGAGAAAGGGCAGTTGG - Intergenic
1143454339 17:7056416-7056438 CTGTGTCCTCACAGGGCAGAAGG - Intergenic
1144620714 17:16816765-16816787 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1144680020 17:17187053-17187075 CTGTCTGCAGAAGGGCCAGTGGG - Exonic
1145147293 17:20492995-20493017 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1145712410 17:26989772-26989794 CAGTGTGCACAAAGGTCACAGGG - Intergenic
1147536375 17:41325310-41325332 CTGTGGGCACCAAGGGCAGCTGG - Intergenic
1147572104 17:41577663-41577685 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1148156274 17:45426760-45426782 GTGTGTGGACAACGGGCAGAAGG - Intronic
1148542704 17:48492987-48493009 CTGTCACCACAAAGGGCAGGAGG + Intergenic
1148910951 17:50942467-50942489 CTGTGGGCACAAGGGGCTGGCGG - Intergenic
1149531190 17:57396770-57396792 CTGTGTGCACAAAGGGCAGTGGG - Intronic
1151698310 17:75729426-75729448 CTGTGTGCACGGTGGGCACTGGG + Exonic
1151905291 17:77044147-77044169 CTGTGTGCACTGTGGGCAGAGGG + Intergenic
1152151153 17:78602214-78602236 CTGCGTGGACAAAGAGCAGACGG - Intergenic
1153450251 18:5219189-5219211 CTGTGTGCACAGAAGTCAGAAGG - Intergenic
1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG + Intergenic
1155619503 18:27761267-27761289 CAGTTAGCACAAAGGACAGTGGG + Intergenic
1155700490 18:28737107-28737129 CTGTGTACACACATGGCAGAAGG - Intergenic
1156509246 18:37621745-37621767 TTGTTTGCACAAAGGGCAGTAGG + Intergenic
1156950687 18:42893421-42893443 CTGTGTCCTCAAAAGGCAGAAGG + Intronic
1158099988 18:53819675-53819697 GTGTGTGCACCAGTGGCAGTTGG - Intergenic
1158396220 18:57080146-57080168 CTGTGTGCTCACATGGCAGAAGG - Intergenic
1158604713 18:58885470-58885492 TTATGTGCACAAAAGGCAGGAGG - Intronic
1158908559 18:62037567-62037589 CTGTGAGCACTGAGGGCAGCGGG + Intergenic
1160226207 18:77013292-77013314 CTGTGTGCACACTGGGCTCTGGG + Exonic
1164983434 19:32630960-32630982 CTGTGCTCAGAATGGGCAGTAGG - Intronic
1165158795 19:33803896-33803918 CCTTGTGCACACAGGGCAGGTGG + Intronic
1165339522 19:35200788-35200810 CTGTGACCACAGAGGGCAGGAGG - Intergenic
1166230660 19:41424415-41424437 CTGTGGGGACATGGGGCAGTGGG - Intronic
1167602573 19:50463034-50463056 CCCTGTTCACAAAGAGCAGTTGG - Intronic
1168413180 19:56152761-56152783 CTGTGTCCTCACAGGGCAGAAGG + Intronic
925866547 2:8233152-8233174 CTATTTGTACAAAGGCCAGTTGG - Intergenic
925868579 2:8250045-8250067 CTGTATGCACAAAGGGTGGTAGG + Intergenic
927279154 2:21288478-21288500 CAGAGTGAACAAAGGGCTGTAGG + Intergenic
927678977 2:25127728-25127750 CTCTGGGCACAAAGGGGTGTCGG - Intronic
931224313 2:60316433-60316455 ATGTCTGCCCAAAGGACAGTTGG - Intergenic
931880672 2:66567258-66567280 CTGTGTACTCAAAGGTCACTGGG + Intronic
933857228 2:86427702-86427724 ATGTGTGCACAAATGTCAGCAGG - Intergenic
934932447 2:98437933-98437955 CTCTGTACACAATGTGCAGTTGG + Intergenic
935245769 2:101217858-101217880 CTTTTTGCAAAAAAGGCAGTGGG + Intronic
935689837 2:105721033-105721055 CTGTGTGCTCACAGGGCAGAAGG + Intergenic
937055408 2:118930900-118930922 CTGTGTGCTCACATGGCAGATGG + Intergenic
937992558 2:127672691-127672713 CTGTGTGGAGAAAGGGCTGCTGG - Intronic
938737811 2:134202362-134202384 CTGTGTACTCAAATGGCAGAAGG - Intronic
939553264 2:143642353-143642375 CTGTTTCCACAAAGGTGAGTTGG - Intronic
939862927 2:147441010-147441032 ATGAGTGTTCAAAGGGCAGTGGG - Intergenic
939903394 2:147879305-147879327 CTGTGTCCTCACAGGGCAGAGGG + Intronic
941505880 2:166344724-166344746 CTGTTTGCACAAAGGATTGTAGG - Intronic
948687438 2:239677847-239677869 CTGAGAGCACAGAAGGCAGTGGG - Intergenic
1168903825 20:1388704-1388726 CTGTGTGGACAATGGGCTTTTGG - Intronic
1169331398 20:4719302-4719324 CTGTGTGCCCACATGGCAGAAGG + Intergenic
1170732053 20:18984338-18984360 CAGTGCGCACAAAGGCCAGAGGG - Intergenic
1172131431 20:32658726-32658748 GTGTGAGCACAAAGGGTAGGTGG + Intergenic
1175989074 20:62778631-62778653 CTGTGTGTACCAAGCCCAGTGGG + Intergenic
1179522843 21:41956340-41956362 CTGTGTGCACACATGGCACGGGG - Intergenic
1180800096 22:18627691-18627713 GGGTGTGCACAAGGGGCAGGGGG - Intergenic
1180851329 22:19023256-19023278 GGGTGTGCACAAGGGGCAGGGGG - Intergenic
1181047345 22:20221864-20221886 CTCTGTGCACAAAGAGAGGTGGG + Intergenic
1181221619 22:21367575-21367597 GGGTGTGCACAAGGGGCAGGGGG + Intergenic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1181997996 22:26898081-26898103 CTGTTTGCACAAATGACTGTAGG + Intergenic
1182455853 22:30450072-30450094 CTGAGACCAGAAAGGGCAGTGGG - Intronic
1182457174 22:30459304-30459326 CTATGTGCAACAAGGGAAGTGGG + Exonic
1183427516 22:37747394-37747416 GTGTGTGCACAGGCGGCAGTAGG + Intronic
1184753148 22:46500510-46500532 CTCTGAGCACAAAGGCCACTGGG + Intronic
949990150 3:9572242-9572264 CTGTCTGCACATAGGGCTTTTGG + Intergenic
951284116 3:20788512-20788534 CTCTGTGGACAAAGGGGAGGTGG - Intergenic
951589209 3:24245003-24245025 CTGTTTGAACAAAGGTCAGGGGG + Intronic
951746434 3:25982801-25982823 CTGTGTTCAGAAAAGGCAGATGG - Intergenic
953156788 3:40382760-40382782 CTGTGTGCCCCCATGGCAGTGGG - Intergenic
953462842 3:43095361-43095383 CTGTAAGCCCAGAGGGCAGTGGG - Intronic
954618450 3:51982578-51982600 CTGGGAGTACAAAGGGCAGCTGG + Intronic
956165226 3:66393244-66393266 CAGTGAGCACAAAAGGCAGGAGG + Intronic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
959912347 3:111778047-111778069 ATGAGTGCCCAAGGGGCAGTAGG - Intronic
960997751 3:123350989-123351011 ATGTGTTAATAAAGGGCAGTGGG + Intronic
962171482 3:133105881-133105903 CTGTGTACCCCATGGGCAGTGGG + Intronic
962467482 3:135673874-135673896 CTGTGTGCTCACATGGCAGAAGG + Intergenic
963847379 3:150172859-150172881 CTGTGTCCTCACAGGGCAGAAGG - Intergenic
963873023 3:150439931-150439953 CTCTGTGCTCAAAGGTCAATTGG + Intronic
964330086 3:155592582-155592604 CTCTCTGACCAAAGGGCAGTCGG + Intronic
964427795 3:156571406-156571428 CTGTGTGGACCAAAGGAAGTAGG + Intergenic
964659783 3:159107302-159107324 CTGTGTCCACAAATGGCAAAAGG - Intronic
965370173 3:167852334-167852356 CTGAGTACACAAAGGGAAATAGG + Intergenic
965565146 3:170107966-170107988 ATGTGTGCCCAAAAGGTAGTAGG + Intronic
968497259 4:925713-925735 CTGTGTCCTCACAGGGCAGAAGG - Intronic
968672245 4:1857799-1857821 CTGTGTCCACACCGGTCAGTGGG + Intergenic
969293942 4:6258095-6258117 CAGTGAGCACAAAGGCCAGCTGG + Intergenic
972263601 4:37437309-37437331 CTGTGTCCTCACAGGGCAGGAGG + Intronic
975299953 4:72778266-72778288 CTAAGTGCACAAAGCACAGTCGG - Intergenic
975494249 4:75020514-75020536 CTGTGTGGACAACAGGGAGTAGG - Intronic
984305414 4:177983193-177983215 CTGTGTCCTCACAGGGCAGAAGG - Intronic
987296812 5:16560576-16560598 TTGTGTAGCCAAAGGGCAGTTGG + Intronic
991201887 5:64004287-64004309 CTGTGTCCTCCAAGGACAGTAGG - Intergenic
991385420 5:66083517-66083539 CTGTGTGCAGAAAGGACATCTGG + Intergenic
991689797 5:69214912-69214934 CTGTGTGCTCACATGGCAGAAGG - Intergenic
992509540 5:77419383-77419405 GTGTTTGCACAGAGTGCAGTGGG + Intronic
993021904 5:82602114-82602136 CTGTGTCCTCAAATGGCAGAAGG + Intergenic
996879334 5:128276867-128276889 CAGTGTGCACAAAAGCCAGGAGG - Intronic
997654013 5:135542290-135542312 TTTTGTGCCCAAAGGCCAGTGGG + Intergenic
997760349 5:136441649-136441671 ATTTCTGCAAAAAGGGCAGTTGG + Intergenic
999100758 5:149024026-149024048 CAGTGTTCTCAAAGGGCTGTTGG + Intronic
1001052751 5:168426071-168426093 ATGTGTGTACAAGGGCCAGTGGG + Intronic
1001669995 5:173465888-173465910 CTGGGCGCACACAGAGCAGTGGG - Intergenic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002426071 5:179176674-179176696 CTGTGTGCAGAAGGGGCAGGTGG - Intronic
1002793679 6:453230-453252 CTCTGTGTGCAAAGGGCAGCTGG - Intergenic
1004903003 6:20211185-20211207 GGGTGTGCGCAAAGGGCAGCAGG + Intronic
1006577906 6:35059409-35059431 CTCTGAGCACAAAGGGCCGGTGG + Intronic
1010388154 6:75306009-75306031 CTGTCTTCACAAATGGAAGTTGG + Intronic
1015723321 6:136269801-136269823 TTGTGTATACAAAGTGCAGTGGG + Intronic
1017777929 6:157694083-157694105 CTGTCTGCAGACAGGGCTGTTGG + Intergenic
1019643435 7:2116585-2116607 CTGTGTGTACACAGGGCTGCAGG + Intronic
1021531883 7:21655898-21655920 GTTTCTGCACACAGGGCAGTTGG + Exonic
1022500502 7:30879600-30879622 CAGCGTGCACAAAGGCCAGGAGG - Intronic
1023526485 7:41108788-41108810 ATGTATGCACAAAGGCCATTGGG + Intergenic
1024325408 7:48105711-48105733 CTGTGTGCTCACATGGCAGAAGG + Intronic
1026468428 7:70674154-70674176 CTGTGTGCTAAAGGGGCGGTGGG + Intronic
1029604439 7:101590218-101590240 CTGTGTGTCCAAAGCCCAGTGGG + Intergenic
1029804427 7:102981692-102981714 CTGTGTCCACACATGGCAGTAGG + Intronic
1030021757 7:105281927-105281949 GTGTCTGCAAAAAAGGCAGTTGG - Intronic
1030814866 7:114023454-114023476 CTGTGTCCTCAAATGGCAGAAGG + Intronic
1031136448 7:117889559-117889581 CTGTGTGATCAAACGGCATTTGG - Intergenic
1032876857 7:136047104-136047126 CTGTGTCCTCACAGGGCAGAAGG + Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035239158 7:157518900-157518922 CTGTGTCCAGGCAGGGCAGTTGG - Intergenic
1038104204 8:24414964-24414986 CTGTGGGCACAGAGGCCTGTGGG - Intergenic
1038611836 8:29065880-29065902 CTCTGAGGACACAGGGCAGTCGG - Intergenic
1040842727 8:51801675-51801697 CAGTGTGCACAAAGCCCATTTGG + Intronic
1041191308 8:55357953-55357975 CTGTGTCAACAAAGGGCATTAGG - Intronic
1049397494 8:142408092-142408114 ATGTGTCCACAGAGGGGAGTGGG - Intergenic
1055326608 9:75136903-75136925 GTATGTGCACACTGGGCAGTGGG + Intronic
1055404621 9:75961957-75961979 CTGTGCTCACCATGGGCAGTAGG + Intronic
1056080432 9:83087449-83087471 CTGTGTTCTCACATGGCAGTAGG - Intergenic
1059881594 9:118696420-118696442 CTGTGTCCTCAAATGGCAGAGGG + Intergenic
1062197086 9:135280325-135280347 TCATGTGCATAAAGGGCAGTGGG + Intergenic
1062397398 9:136357991-136358013 CTGGGTGGACACAGTGCAGTTGG - Intronic
1185697877 X:2209005-2209027 CTGTGTGCTCACAAGGCAGTGGG + Intergenic
1185817474 X:3169702-3169724 CCTTGTGGACAAAGGGCAGAAGG - Intergenic
1186123218 X:6384925-6384947 CTGTGTTCATAAAGAGAAGTGGG + Intergenic
1190157301 X:48004396-48004418 CTGCGTGCACAAAGAGTAGGAGG + Exonic
1190173071 X:48127281-48127303 CTGCGTGCACAAAGAGTAGGAGG + Intergenic
1190846286 X:54194417-54194439 CTGTGTGCCTAAAGGGCAATGGG - Exonic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1195487750 X:105428816-105428838 ATGAGTGCACAAAGGTCAGGTGG + Intronic
1198812603 X:140550834-140550856 CTCTGTGCACAAAGGAAGGTTGG + Intergenic
1199689551 X:150298063-150298085 CAGTGTGCACACAGTGCATTGGG + Intergenic
1199705678 X:150422873-150422895 CTGTGTGCACTAAAGGCACAAGG - Intronic
1199719378 X:150531422-150531444 CTGTGTGCACACCAGGCACTGGG + Intergenic
1199751248 X:150821133-150821155 ATTTCTGCACAAAAGGCAGTTGG - Intronic
1199993360 X:153002805-153002827 CTGTGGTCATAAAGGGCATTTGG - Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1201222892 Y:11789129-11789151 CTGTGTTTAGAAAGGCCAGTGGG + Intergenic
1201473821 Y:14360058-14360080 CTGTGTTCATAAAGAGTAGTGGG - Intergenic
1201610375 Y:15836226-15836248 CTTTGTGCCCATAGAGCAGTGGG - Intergenic