ID: 1149531689

View in Genome Browser
Species Human (GRCh38)
Location 17:57400742-57400764
Sequence CCTGCAGGTCCTTCTCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 385}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149531689_1149531702 20 Left 1149531689 17:57400742-57400764 CCCCAAGGAGAAGGACCTGCAGG 0: 1
1: 0
2: 6
3: 38
4: 385
Right 1149531702 17:57400785-57400807 GGGATTAGCTGGGCTTGACTGGG 0: 1
1: 0
2: 0
3: 24
4: 201
1149531689_1149531703 26 Left 1149531689 17:57400742-57400764 CCCCAAGGAGAAGGACCTGCAGG 0: 1
1: 0
2: 6
3: 38
4: 385
Right 1149531703 17:57400791-57400813 AGCTGGGCTTGACTGGGTGCAGG 0: 1
1: 0
2: 2
3: 30
4: 283
1149531689_1149531699 9 Left 1149531689 17:57400742-57400764 CCCCAAGGAGAAGGACCTGCAGG 0: 1
1: 0
2: 6
3: 38
4: 385
Right 1149531699 17:57400774-57400796 GTAGGGATCTGGGGATTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 118
1149531689_1149531700 10 Left 1149531689 17:57400742-57400764 CCCCAAGGAGAAGGACCTGCAGG 0: 1
1: 0
2: 6
3: 38
4: 385
Right 1149531700 17:57400775-57400797 TAGGGATCTGGGGATTAGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 133
1149531689_1149531698 0 Left 1149531689 17:57400742-57400764 CCCCAAGGAGAAGGACCTGCAGG 0: 1
1: 0
2: 6
3: 38
4: 385
Right 1149531698 17:57400765-57400787 AACGAAAGTGTAGGGATCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 121
1149531689_1149531695 -8 Left 1149531689 17:57400742-57400764 CCCCAAGGAGAAGGACCTGCAGG 0: 1
1: 0
2: 6
3: 38
4: 385
Right 1149531695 17:57400757-57400779 CCTGCAGGAACGAAAGTGTAGGG 0: 1
1: 0
2: 0
3: 4
4: 99
1149531689_1149531704 27 Left 1149531689 17:57400742-57400764 CCCCAAGGAGAAGGACCTGCAGG 0: 1
1: 0
2: 6
3: 38
4: 385
Right 1149531704 17:57400792-57400814 GCTGGGCTTGACTGGGTGCAGGG 0: 1
1: 0
2: 3
3: 32
4: 289
1149531689_1149531697 -1 Left 1149531689 17:57400742-57400764 CCCCAAGGAGAAGGACCTGCAGG 0: 1
1: 0
2: 6
3: 38
4: 385
Right 1149531697 17:57400764-57400786 GAACGAAAGTGTAGGGATCTGGG 0: 1
1: 0
2: 1
3: 6
4: 76
1149531689_1149531701 19 Left 1149531689 17:57400742-57400764 CCCCAAGGAGAAGGACCTGCAGG 0: 1
1: 0
2: 6
3: 38
4: 385
Right 1149531701 17:57400784-57400806 GGGGATTAGCTGGGCTTGACTGG 0: 1
1: 0
2: 0
3: 12
4: 147
1149531689_1149531696 -2 Left 1149531689 17:57400742-57400764 CCCCAAGGAGAAGGACCTGCAGG 0: 1
1: 0
2: 6
3: 38
4: 385
Right 1149531696 17:57400763-57400785 GGAACGAAAGTGTAGGGATCTGG 0: 1
1: 0
2: 0
3: 8
4: 85
1149531689_1149531693 -9 Left 1149531689 17:57400742-57400764 CCCCAAGGAGAAGGACCTGCAGG 0: 1
1: 0
2: 6
3: 38
4: 385
Right 1149531693 17:57400756-57400778 ACCTGCAGGAACGAAAGTGTAGG 0: 1
1: 0
2: 1
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149531689 Original CRISPR CCTGCAGGTCCTTCTCCTTG GGG (reversed) Intronic
900237371 1:1599207-1599229 CCGGCAGGTCCTCCTCCGCGGGG + Exonic
900292028 1:1927707-1927729 CATGCAGGTCCTTCCTCTGGGGG + Exonic
900385484 1:2408697-2408719 CCTGCAGCTCCTGCTCCAGGGGG + Exonic
900427939 1:2588974-2588996 CCTGCAGGATGTGCTCCTTGGGG - Exonic
900582148 1:3414599-3414621 GCCGCAGGTACTTCTCCTTCAGG - Exonic
902362235 1:15948197-15948219 CCTGCAGGTGCTGCCCCTGGAGG + Intronic
902864346 1:19268646-19268668 CCTGCAGGGCCTTCTCCACCAGG + Intergenic
902866568 1:19284070-19284092 CCTGCAGGGCCTTCTCCACCAGG + Exonic
903664785 1:24999661-24999683 CCTACAGGCCTTTCTCCTGGTGG + Intergenic
903879988 1:26501588-26501610 CCTGGAGCTCTTTCTCCATGTGG - Intergenic
904252144 1:29232708-29232730 CCAGCAAGTCCTCCTCCTTGGGG + Intergenic
905019118 1:34796238-34796260 CCTTCAGTTGCTTCTCCTGGTGG - Intronic
905240242 1:36576551-36576573 CCTGGAGGTCCCACTCCTTAGGG - Intergenic
905579923 1:39076539-39076561 CAATCAGGTCCTTGTCCTTGAGG - Intergenic
906878105 1:49559674-49559696 CCTGCAGGTTCTTCAGCTTTTGG + Intronic
907296868 1:53461068-53461090 CCTCAAGGACCTTGTCCTTGTGG + Intronic
907550830 1:55303346-55303368 CCTGCAGCTCCTGCTCTTTCTGG - Intergenic
907651509 1:56299352-56299374 CCAGCACTTCCTTTTCCTTGTGG + Intergenic
909265972 1:73558579-73558601 CCTGCAGGTCCAACACCATGTGG - Intergenic
910719584 1:90271547-90271569 ACTGGGGGTCCTTCTTCTTGGGG + Intergenic
911715035 1:101123260-101123282 CATCCAGTTCATTCTCCTTGTGG + Intergenic
913315544 1:117548211-117548233 TCTGCAGGGCTTTTTCCTTGAGG + Intergenic
913374325 1:118133715-118133737 CCTGCATGTCCTTCTTCTGAAGG + Intronic
914859447 1:151374050-151374072 CCTTCAGGGCCTTCCCCGTGGGG - Intergenic
914875964 1:151512884-151512906 CCTGCATGCCATTCCCCTTGTGG + Intronic
916238823 1:162618183-162618205 CCTGGAGGCGCTTCTCCTTTTGG + Intergenic
916683933 1:167127642-167127664 TCTGCATCTCCTTCTCCTTCCGG - Exonic
920035695 1:203063950-203063972 CCCGCAGGTCCTTCTTGGTGAGG - Exonic
920852765 1:209639846-209639868 CCTGCAGGTCCTTCTGGGTAGGG + Intronic
921098402 1:211907223-211907245 CCTGCAGTTCCAGCTACTTGGGG + Intergenic
923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG + Intronic
923663358 1:235977912-235977934 ACGGCAGGTCCTGCTCCCTGGGG + Exonic
1063876547 10:10484438-10484460 CCTGTAGTTCCAGCTCCTTGGGG - Intergenic
1064397252 10:14991881-14991903 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1064400148 10:15014350-15014372 CCTGCACCTCTCTCTCCTTGCGG + Intergenic
1066390373 10:34973278-34973300 CCTGCACCTCTCTCTCCTTGTGG - Intergenic
1066566390 10:36725841-36725863 CATGTAGGTCATTCTCCTTTAGG - Intergenic
1070843850 10:79506495-79506517 CCTGCAGCTCCTTGTCCTCCCGG - Intergenic
1070966236 10:80532962-80532984 CCTGCAGGTCCCTCTCTGGGGGG + Exonic
1070973684 10:80588056-80588078 CATCCAGGTCCTACTGCTTGCGG + Intronic
1071555333 10:86597279-86597301 CCTGCAAGGCCCTCGCCTTGAGG + Intergenic
1072984483 10:100128005-100128027 CCTGCAGCTCCAGCTCCTTCAGG - Intergenic
1073006931 10:100331376-100331398 CCTGCAGTTTCTCCTCCTTGAGG + Intergenic
1073705056 10:105973674-105973696 CCTGGAGCCCCTCCTCCTTGCGG - Intergenic
1073985889 10:109208490-109208512 CCTGCATGCTCATCTCCTTGAGG + Intergenic
1074085136 10:110204091-110204113 CTCACAGCTCCTTCTCCTTGGGG - Intergenic
1074327792 10:112469830-112469852 TCTGGAGCTCCTTCTCTTTGTGG + Intronic
1074901459 10:117819500-117819522 CCTGCATGTCATTCTCAGTGGGG + Intergenic
1075189661 10:120295162-120295184 CCTCCTGATCCTTCCCCTTGAGG + Intergenic
1076017515 10:127040014-127040036 CGTGCAGCTCCATCTCCCTGTGG + Intronic
1076804074 10:132846513-132846535 CCAGCAGGTCCCTGTCCGTGTGG - Intronic
1076804091 10:132846592-132846614 CCAGCAGGTCCCTGTCCGTGTGG - Intronic
1077337545 11:2012162-2012184 CCGGCAGGACCCTCCCCTTGAGG + Intergenic
1077434354 11:2531628-2531650 CCTGCAGCTCCCTCTCCTCCGGG + Intronic
1077541855 11:3150417-3150439 CCAGCAGCTCCTCCTCCTTAGGG + Intronic
1078180040 11:9003881-9003903 CCCGCATGTCGGTCTCCTTGCGG + Exonic
1078264926 11:9747972-9747994 CCTGCAGGGCCTGTTCCTTCAGG - Exonic
1078715357 11:13834315-13834337 CCTGCAGGTCTTTATCATTCTGG + Intergenic
1079076925 11:17389753-17389775 CCTGCAGCTGCTTCTCTTTGGGG + Intergenic
1081596353 11:44462189-44462211 CTCACAGGTCCCTCTCCTTGGGG + Intergenic
1081815109 11:45934746-45934768 GCTGCAGGCCTTTGTCCTTGGGG - Intronic
1084056721 11:66638719-66638741 CCAGCAGGGCCTCCTCCTCGCGG - Intronic
1084261147 11:67979547-67979569 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1084807490 11:71589007-71589029 CCTGCACCTCTCTCTCCTTGGGG - Intronic
1084847433 11:71911470-71911492 CCTGCACCTCTCTCTCCTTGGGG - Intronic
1084908808 11:72370858-72370880 CCTGCAGTGCCCTCTCCTTTAGG + Intronic
1085045576 11:73351076-73351098 GCTGCTGCTCCTGCTCCTTGTGG + Intronic
1085121200 11:73968682-73968704 CCTCCAGGCTCTTCTCCTTAGGG + Intronic
1085704564 11:78775021-78775043 ACTGCAGGAGCTTCTTCTTGAGG - Intronic
1085841139 11:80013012-80013034 CCTGAGGGGCCTTCTCCTTAGGG - Intergenic
1086133154 11:83421365-83421387 CCTGCAGGACCTTCTCCATCAGG + Intergenic
1086324566 11:85685404-85685426 CCTGCTGGTGCTGCTGCTTGAGG + Exonic
1089169565 11:116502734-116502756 CCTGCAGGACCTCCTCTTGGAGG - Intergenic
1202820529 11_KI270721v1_random:67344-67366 CCGGCAGGACCCTCCCCTTGAGG + Intergenic
1092432408 12:8420103-8420125 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1093974263 12:25403605-25403627 CTTGTAGGTCATTTTCCTTGGGG + Intergenic
1095562934 12:43587034-43587056 ATTGCAATTCCTTCTCCTTGGGG - Intergenic
1096370334 12:51064027-51064049 CATTCAGATCCTTCTCCTTTGGG + Exonic
1096609133 12:52789642-52789664 GCTCCATGTCCTTCTCCTTAGGG - Intergenic
1096735695 12:53652095-53652117 CCTGTAGGTCCAGCTACTTGGGG + Intronic
1097686133 12:62692613-62692635 CCTGCAGCTCCATTTCTTTGTGG - Intronic
1097732902 12:63150443-63150465 CCTGCAGGTGCTTCACCACGCGG + Exonic
1101002991 12:100374925-100374947 GCTGTAGGTCCTGCTTCTTGTGG + Intronic
1101029273 12:100644081-100644103 CCTGCACATCTTTCTCCTTGTGG + Intergenic
1101838588 12:108311950-108311972 CTTGCAGGTCCCTCTGCCTGGGG + Intronic
1103931386 12:124452857-124452879 CCTTCGGGGCCTTCGCCTTGTGG - Intronic
1104742057 12:131184899-131184921 CCTGCAGGCCCAACTCCATGTGG + Intergenic
1106001414 13:25726932-25726954 ACTGCACCTCCTTCTCCTTGGGG - Intronic
1107016543 13:35712070-35712092 CCTGGAGGGCCTTCTCCTTGGGG - Intergenic
1107544189 13:41421669-41421691 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1108729353 13:53217401-53217423 CCTGAAGTCACTTCTCCTTGTGG - Intergenic
1109570629 13:64184019-64184041 GCAGCAGGTACTGCTCCTTGTGG - Intergenic
1109802977 13:67401716-67401738 CCTGCACATCTTTCTCCTTGTGG - Intergenic
1112892474 13:104255255-104255277 CCAGCAGGTCCTCCTCCCTCTGG - Intergenic
1113735223 13:112673736-112673758 CATCCAGGTCCTTGTGCTTGTGG + Intronic
1116796940 14:49401333-49401355 CCTGCAGTTGGTTCTCTTTGTGG - Intergenic
1120245810 14:82004729-82004751 CCTGCCAGTCTTTCTCCTGGAGG + Intergenic
1120828204 14:88974291-88974313 CCTGTAGGTCCTTCACCTCTTGG - Intergenic
1121355418 14:93209869-93209891 CCTGCTGGTTCTTCTCCCTCTGG - Exonic
1121873464 14:97430255-97430277 CCTGGAGGCCCAGCTCCTTGAGG + Intergenic
1122918538 14:104869962-104869984 CCAGCAGGTCTCTCACCTTGTGG + Intronic
1123044597 14:105505196-105505218 CCTGCTGGTCCCTCTCCTTCGGG - Intergenic
1124023930 15:25947431-25947453 CATGTAGGTCATTCTCCTTTTGG + Intergenic
1124058939 15:26269680-26269702 CCTGCAGTTCCTTCTCATGTGGG - Intergenic
1125490803 15:40147205-40147227 CCTTCTGGTTCTGCTCCTTGGGG - Intergenic
1126384882 15:48084090-48084112 CCTGCAGCAACTTCACCTTGGGG - Intergenic
1126565949 15:50099401-50099423 CCTGTAGTTCCAGCTCCTTGGGG - Intronic
1127003179 15:54534214-54534236 GCAGCAGGTGCTTGTCCTTGAGG + Intronic
1127096330 15:55515301-55515323 CCTGCATGTCTTTCTCCTTGTGG + Intergenic
1128208007 15:65869864-65869886 CCTGCGTGTCCTTCCCCTGGCGG + Intronic
1128259630 15:66223896-66223918 CCTGTACGTCCCCCTCCTTGGGG + Intronic
1128713268 15:69887878-69887900 CCTGCTGGTCCCTCTGCCTGGGG - Intergenic
1130304554 15:82704494-82704516 CCTACAGGACCTTCTCCATCAGG + Intronic
1130879752 15:88044904-88044926 CCTGAAGGTACTTCTGCTGGGGG + Intronic
1131034175 15:89210428-89210450 CCTGCAGGTCTTTGTCCACGGGG - Exonic
1131640016 15:94282832-94282854 CCTGCATGCCCTTATCATTGGGG + Intronic
1132150492 15:99455012-99455034 CCAGCAGGTTTATCTCCTTGTGG - Intergenic
1132335538 15:101046131-101046153 CCTGCAGGTCCATCTCCGCCAGG - Exonic
1132375947 15:101328224-101328246 CCTGCAGCGTCTTCTCCCTGAGG + Intronic
1132989713 16:2786508-2786530 TCTCCAGGTCCTGCTCCTTCTGG - Exonic
1133003058 16:2860768-2860790 CTACCAGGTCCTTCTCCTCGGGG - Intergenic
1134039812 16:11059956-11059978 CCTGCAGGCCTCTCTCCCTGAGG - Intronic
1134893885 16:17866441-17866463 CCTGTAGTTCCATCTACTTGGGG + Intergenic
1137246513 16:46710538-46710560 CGTGAAGGTCCTTCTTCCTGTGG - Intronic
1137365937 16:47859488-47859510 CCTGCAGATCCTGCTGCTTCTGG - Intergenic
1137581592 16:49636853-49636875 CCTGCAGGTCAGCCTCCTTGCGG + Exonic
1138724330 16:59119525-59119547 TCTGGAGGTCTTTCTTCTTGAGG + Intergenic
1139673278 16:68506182-68506204 CCAGCAGTTCCTTCTCCAGGTGG - Intergenic
1140139997 16:72246519-72246541 CCTGCTGTCCCTTCTGCTTGAGG + Intergenic
1141039060 16:80655855-80655877 CCTCGAGGTCCCTCTCCTTCAGG + Intronic
1141110303 16:81266204-81266226 CCTTCTGGACCTTCTCCATGTGG + Intronic
1141410515 16:83829869-83829891 CCTGCAGCTCCATCACCATGGGG - Intergenic
1142471604 17:166183-166205 CCTGCTGGTCCTTTTGCTTTTGG - Intronic
1142921191 17:3188329-3188351 TCTGCAGGTTTTTCTCTTTGGGG + Intergenic
1143505577 17:7362994-7363016 CCTGCAGTCCCTGCTACTTGGGG - Intergenic
1145864874 17:28234709-28234731 CCTGCAAATCTCTCTCCTTGTGG + Intergenic
1146212964 17:30956387-30956409 CCTGCTGTTCCTTCTCACTGGGG - Exonic
1146263989 17:31439013-31439035 AGTGCAGGTCCTTCTCCTTTGGG - Intronic
1147157522 17:38551777-38551799 CCTGTGGGTCTTTTTCCTTGGGG - Intronic
1148210745 17:45807003-45807025 CCTGCAGGCCCTTCTCCTTCTGG + Exonic
1148840313 17:50491376-50491398 CCTGCTGTCCCTTCTCCCTGAGG + Intergenic
1148847709 17:50538901-50538923 GCTGCAGGTCCTCGTCCCTGTGG - Exonic
1149430794 17:56594388-56594410 CGTTCAGATCCTTTTCCTTGGGG - Exonic
1149531689 17:57400742-57400764 CCTGCAGGTCCTTCTCCTTGGGG - Intronic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1152305595 17:79518641-79518663 CTTGCAGGTCCTCCTCCCAGGGG - Intergenic
1153015728 18:580816-580838 CCTGCAGCTCCTCATCCGTGAGG - Exonic
1153826638 18:8881462-8881484 ACTGCAGGTCCTTCCCCTAGGGG - Intergenic
1153934287 18:9906992-9907014 CCTGCAGTTCCAGCTACTTGGGG + Intergenic
1155892693 18:31287702-31287724 CCTACAGGACCTTCTCCATTGGG - Intergenic
1156022699 18:32617899-32617921 CCTGATGGTCTTTCCCCTTGAGG + Intergenic
1157591515 18:48838978-48839000 CCTGGAGGTCCTTCTCCGGGAGG - Intronic
1157609395 18:48946902-48946924 CCTGCTGGTCTTTATCCCTGGGG + Intronic
1158292215 18:55954955-55954977 CCTGCACATCTTTCTCCTTGTGG - Intergenic
1160225773 18:77009667-77009689 CCTGCAGCTGCTTTTCCCTGGGG + Intronic
1160619078 18:80157943-80157965 CCTCCCGCTGCTTCTCCTTGTGG - Exonic
1160699164 19:497840-497862 CCTGCAGGGGCTTCACCTGGAGG - Exonic
1161221266 19:3119286-3119308 CCAGCAGGTCCTTCTTGTTGAGG - Exonic
1161316731 19:3620754-3620776 CCTTCAGCTCCTTCTCCTCCAGG + Exonic
1161356511 19:3822113-3822135 CGTGCAGGTCCTTCGCGTTAAGG + Exonic
1161539174 19:4839386-4839408 CCTGGAGGTCCTCCACCTGGCGG + Exonic
1162261199 19:9535563-9535585 CCTGTAGTCCCATCTCCTTGGGG + Intronic
1162284231 19:9726329-9726351 CCTGCACATCTTTCTCCTTGTGG + Intergenic
1162924053 19:13920778-13920800 CCTGCAGGAGCTGCTTCTTGCGG - Exonic
1163943232 19:20514037-20514059 TCTGCACATCTTTCTCCTTGTGG + Intergenic
1165120967 19:33558239-33558261 CCTGCAGATCCTTCCCTCTGGGG + Intergenic
1165444308 19:35848529-35848551 CCTGGGGGGCTTTCTCCTTGAGG - Intronic
1165453104 19:35896523-35896545 CCTGCAGACCCCTCTCCTGGTGG - Exonic
1165745421 19:38227813-38227835 CCTGCAGCTCCTTCTCCCCAGGG + Intronic
1166186334 19:41141549-41141571 CTTGCTGTTCCTTCTCCCTGAGG - Intergenic
1166267965 19:41696650-41696672 CCTGCATCACCTTCTCCCTGTGG - Intronic
1167568622 19:50272696-50272718 CCTGCAGCTCCTCCTCCTTCCGG - Exonic
1167715618 19:51141387-51141409 CCTGCAGGAACTGCTCCTAGGGG - Intergenic
1167942578 19:52959480-52959502 CCTGCACATCTCTCTCCTTGTGG - Intronic
1168316055 19:55485262-55485284 CTTGCTGGTCCTTGTTCTTGTGG + Intronic
1168611446 19:57804020-57804042 CCTGCCGGTCCCTCCCCTAGGGG - Intronic
924964183 2:60084-60106 CCTGCAATTCCTTATCCCTGGGG + Intergenic
925267460 2:2576153-2576175 CCTGCAGTTCCCAGTCCTTGGGG + Intergenic
926132343 2:10311700-10311722 CCTGTAGCTCCTTCCCCCTGTGG + Intronic
927880954 2:26689860-26689882 CCAGTCGCTCCTTCTCCTTGAGG - Intergenic
928696096 2:33851693-33851715 CGTGCAGGTCCTTCTCCCTGGGG - Intergenic
928749895 2:34459048-34459070 CCTGCAGGTCCAACACCATGTGG - Intergenic
929178171 2:39002939-39002961 CCTGTAGTTCCTCCTACTTGGGG + Intronic
929568764 2:43006699-43006721 CCTGCAGCCCATACTCCTTGAGG - Intergenic
929724597 2:44412111-44412133 CAAGCAGTTCCATCTCCTTGTGG - Intronic
930536118 2:52648287-52648309 CCTGCAGGTCCAACACCATGGGG + Intergenic
931987827 2:67758373-67758395 CCAGCTGCTCCTTCTTCTTGTGG + Intergenic
932349916 2:71023394-71023416 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
932353413 2:71049524-71049546 CCTGCACATCTCTCTCCTTGTGG - Intergenic
932410593 2:71545011-71545033 CATGCATGTCCTTCTCTTCGAGG - Intronic
933220638 2:79683738-79683760 CCTGCAGCTCCTGCAACTTGTGG - Intronic
934017301 2:87901135-87901157 ACATCAGGTCCTTCTCTTTGTGG + Intergenic
934675772 2:96248757-96248779 CCTGCAGGCCCTGCACCTTCAGG + Exonic
934947038 2:98549784-98549806 CCTGGGGGTCCTTTTCCCTGGGG + Intronic
935568546 2:104635149-104635171 CATGCTGGTCCTTCTGCCTGGGG + Intergenic
935636960 2:105256381-105256403 CCTGCTGCTCCTTCTGCCTGGGG + Intergenic
935637820 2:105263395-105263417 CCTGCAGGTCCTCCCACCTGGGG - Intergenic
935682341 2:105648689-105648711 ATTGCATGTCCTTCTCCTTAAGG - Intergenic
936045135 2:109181611-109181633 ACTGCAGGTCCTTATGCTGGAGG - Intronic
937692611 2:124772914-124772936 CCTGCAGGGAGGTCTCCTTGAGG - Exonic
938244513 2:129766321-129766343 CCTGCACGTCCTGCTCCTGGAGG - Intergenic
940038942 2:149339243-149339265 CCATCAGGTGCTTCTCTTTGAGG + Intronic
940869494 2:158848171-158848193 CCTGCACCTCTCTCTCCTTGGGG - Intronic
940872168 2:158869169-158869191 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
942087316 2:172455468-172455490 CTTGCTGGCCCTTCTCCATGGGG - Intronic
943061574 2:183046130-183046152 CCTACAGGACCTTCTCCATCAGG + Intergenic
947594973 2:231405316-231405338 CCTGCACCTCTCTCTCCTTGTGG - Intergenic
947888083 2:233592148-233592170 CCTGCTGTCCCTGCTCCTTGGGG - Intergenic
947894310 2:233655379-233655401 CCTGCTGTCCCTGCTCCTTGGGG - Intronic
948141910 2:235679702-235679724 CCTGCTGTGCCTTCTCCTGGAGG + Intronic
948216924 2:236239061-236239083 CATGCAGGTCCATGTCCCTGGGG - Intronic
948309057 2:236971634-236971656 CCTGCATGGACTACTCCTTGAGG + Intergenic
948752622 2:240141303-240141325 CCTCCTGGTCCTGCTCCTTGGGG + Intronic
1168965610 20:1896174-1896196 CCTGGTGGTCTTGCTCCTTGAGG + Intronic
1169317307 20:4603273-4603295 TCTGCAGATCCTGCTCCTTCTGG + Intergenic
1171408519 20:24930033-24930055 CCTGCACATCTCTCTCCTTGTGG - Intergenic
1172010747 20:31844504-31844526 CCTGCAGGTCCCTCACCCTCCGG - Exonic
1172293279 20:33791157-33791179 TTTGCAGGTCCTTGTCCTTTTGG - Exonic
1172436324 20:34931287-34931309 CCTGCTAGTCCCTCTCATTGAGG + Intronic
1172665323 20:36595314-36595336 CCTACAGGTCACTCTCCTTCAGG + Intronic
1172789558 20:37493393-37493415 CCCACTGCTCCTTCTCCTTGTGG - Intronic
1173618636 20:44419605-44419627 CCTGCAGGTCCTCCTCCCACAGG + Intronic
1173890840 20:46508731-46508753 CATGCAGGACCTTCTCCTACAGG + Intronic
1174063698 20:47849857-47849879 CCTGCAGATCCTTCTACATGGGG - Intergenic
1175913204 20:62414294-62414316 CATGCAGGACCTTCGCCTGGAGG - Exonic
1178447691 21:32660580-32660602 CCTGCACATCTTTCTCCATGTGG - Intronic
1179345671 21:40554457-40554479 CCCTCAAGTCCTTCACCTTGTGG + Intronic
1179794313 21:43773880-43773902 CGGGCAGGTCCTTCCCCTCGGGG - Exonic
1179821112 21:43937461-43937483 ACTGCAGGCCTGTCTCCTTGAGG + Intronic
1179887412 21:44320135-44320157 CCTGCCTCACCTTCTCCTTGGGG - Exonic
1179902573 21:44401675-44401697 CCTGCAGCCTCTTCTCCCTGCGG - Exonic
1180179706 21:46112448-46112470 CCCGCAGGCCCTGCTCCTTCAGG - Exonic
1180998810 22:19978441-19978463 CCTGCAGGCTCTTGACCTTGGGG - Intronic
1181004090 22:20001501-20001523 CCAGCAGCTCCTTTTCATTGTGG - Intronic
1181468412 22:23123167-23123189 CCAGCAGGTCCTTCTTGTTCAGG - Exonic
1181486212 22:23233290-23233312 CCTGCCGGCCTTTCTCCTGGTGG + Intronic
1183446435 22:37859039-37859061 CCTGCTGCTGCTTCTGCTTGGGG + Intronic
1184489336 22:44800065-44800087 TCTGCAGGGCCCTCTCCTTCAGG + Intronic
949884528 3:8682754-8682776 CCTGCACCTCTCTCTCCTTGGGG - Intronic
950434219 3:12968772-12968794 CCTACAAGTCCATCTCCTGGAGG + Intronic
951544914 3:23815102-23815124 CCTGTAGTTCCTGCTACTTGGGG - Intronic
952794041 3:37223290-37223312 CATTCAGATTCTTCTCCTTGAGG + Intergenic
953023312 3:39129811-39129833 CCTCCAGATCCCTCTCCATGAGG - Intronic
953420056 3:42747343-42747365 CCTGCAGGGCCTTCACCTCTGGG + Exonic
953926193 3:46983716-46983738 ACTACAGGCCCTTCTCCTTCAGG - Intronic
954715678 3:52525525-52525547 CCTCGAGGGCCTTCTCCCTGTGG + Intronic
954993125 3:54858188-54858210 TCTGCACCTCCTTCCCCTTGTGG + Intronic
954994790 3:54871643-54871665 AATGCAGGTCCTTCTCCACGAGG - Intronic
956082246 3:65569751-65569773 CCTGTAGTCCCTTCTACTTGGGG + Intronic
956255394 3:67278129-67278151 CCTGCAGGTCTTACTCACTGGGG + Intergenic
957044420 3:75362925-75362947 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
957406257 3:79777368-79777390 CCTGCACATCTTTCTCCTTGTGG - Intergenic
957734865 3:84191268-84191290 CCTACAGGACCTTCTCCATCAGG - Intergenic
958930354 3:100201388-100201410 CCTGCAGTCCCTGCTACTTGGGG - Intergenic
960225379 3:115161972-115161994 CCTGGAGGTGCTTCCCATTGGGG + Intergenic
960942377 3:122943299-122943321 TCTGCTGGGCCCTCTCCTTGTGG - Intronic
961278004 3:125742701-125742723 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
961726221 3:128932753-128932775 ACTGCAGGTACTTCTCCTGGTGG + Exonic
961876412 3:130026959-130026981 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
962878708 3:139555894-139555916 CCTCCCTGCCCTTCTCCTTGGGG - Intergenic
964267938 3:154921336-154921358 CCTGCAGGTCCAGCACCATGTGG + Intergenic
964522421 3:157583404-157583426 CCTGCACATCTTTCTCCTTGTGG + Intronic
965176789 3:165345253-165345275 CCACCAGGTCCTTCTACATGTGG - Intergenic
965301564 3:167011453-167011475 CCTGCAGGTCCAACACCATGTGG + Intergenic
966938917 3:184732948-184732970 CCTGGGGGTCCTTCTTCTTGAGG + Intergenic
967887775 3:194345031-194345053 CCTCCAGGTCCTTCTTCCTAGGG - Intronic
968653939 4:1770679-1770701 CCATCAGGTGCTTCTCCTGGGGG - Intergenic
968919699 4:3516124-3516146 CCTCCAGCTCCTTGTCCGTGAGG + Exonic
968946742 4:3668905-3668927 CCTGGGGCACCTTCTCCTTGGGG + Intergenic
968988684 4:3894165-3894187 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
969019663 4:4131408-4131430 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
969024367 4:4161808-4161830 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
969025272 4:4167754-4167776 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
969646964 4:8436301-8436323 CCTGCACATCTCTCTCCTTGTGG - Intronic
969793776 4:9510064-9510086 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
970132953 4:12891190-12891212 CCTGCAGGTGCTTCTGCTAATGG - Intergenic
970609093 4:17709119-17709141 CCTGCAGCTCCTCGGCCTTGCGG + Exonic
972077450 4:35105039-35105061 CCTGCACATCTTTCTCCTCGTGG - Intergenic
972208697 4:36810598-36810620 CTGGCAGCTTCTTCTCCTTGAGG - Intergenic
972251708 4:37309136-37309158 CCTGCAGGGCCTTCTCCATCAGG - Intronic
974199859 4:58623540-58623562 CCTGGAGGACCTGCTTCTTGAGG - Intergenic
974341411 4:60618452-60618474 CTTGCAGGTCCTTGTTCTTGAGG - Intergenic
974870772 4:67638287-67638309 TCTTCAGGTCCCTCTGCTTGTGG - Intronic
975763056 4:77636465-77636487 CCTGGAGGTCCTTCACCTCCAGG + Intergenic
976002189 4:80386535-80386557 TTTGCAGGTCCTTTTCCTTCTGG + Intronic
976326390 4:83776523-83776545 CCAGCACATCCTTTTCCTTGTGG + Intergenic
980780124 4:137482850-137482872 CCTGCACATCTTTCTCCTTGTGG - Intergenic
983536164 4:168859369-168859391 CCAGCAGAGCCTTCTCCTTCAGG - Intronic
984067192 4:175062718-175062740 CCTGCTGGACCTTCTGCCTGTGG + Intergenic
984552733 4:181180340-181180362 CATGCTGATCCTTCTACTTGTGG + Intergenic
984761585 4:183367019-183367041 GGTGCAGGTGATTCTCCTTGGGG - Intergenic
985641120 5:1063894-1063916 TCTGCAGGTCCTTCTTCATCTGG + Exonic
985786486 5:1898007-1898029 CGGGCAGCTCCTTCACCTTGTGG - Intergenic
986068476 5:4259196-4259218 CCTGCTGCTGCTTCTCCATGTGG - Intergenic
986969029 5:13310741-13310763 CCTGCAATTCCCTCTCCTTGAGG - Intergenic
988149961 5:27364660-27364682 CCCGCAGGTTCTTCACCATGTGG - Intergenic
990140971 5:52703598-52703620 CCTCCATGACTTTCTCCTTGAGG - Intergenic
990383176 5:55234718-55234740 CCTGCAGCCCCTTCTCCTATAGG - Intergenic
992039718 5:72817274-72817296 CCGGCGGTTCTTTCTCCTTGGGG + Intronic
992805620 5:80334564-80334586 CCTGCAGTTCCAGCTACTTGGGG + Intergenic
993055424 5:82974805-82974827 CCTGCTGGTCCCTCCCCTAGGGG - Intergenic
995473809 5:112528448-112528470 CCTGCACATCTTTCTCCTTATGG - Intergenic
996345655 5:122486078-122486100 CCTGGAAGTTCTTCTCCTGGTGG - Intergenic
998845089 5:146300669-146300691 CCTGCAGGTGCTTACCCTTTGGG - Intronic
999326571 5:150647963-150647985 CTTTCAGATCCTTCTCCGTGAGG - Exonic
999368626 5:151039162-151039184 CCTGCAGGTACTTGACCTTTTGG + Exonic
999410444 5:151345573-151345595 CCTGCATGCCTTTCTCCCTGTGG + Intronic
1000513795 5:162215654-162215676 CCTGCTGGTCCTTCACTTTCAGG - Intergenic
1001516597 5:172359657-172359679 CATGCAGGCCTTTCTCATTGGGG - Intronic
1002408159 5:179052633-179052655 CCTGCGCATCTTTCTCCTTGCGG + Intergenic
1002641679 5:180633455-180633477 TCTGCAGCCCCTTCCCCTTGGGG + Intronic
1003051163 6:2782383-2782405 CCTGCAGGTCTTTCCCCTGTGGG + Intronic
1003331995 6:5136726-5136748 CCTACAGGCGCTGCTCCTTGGGG - Intronic
1004319676 6:14622570-14622592 CTTGAAGGTGCTTCTCCTCGAGG + Intergenic
1006619781 6:35355426-35355448 CCTGTAGTTCCTACTCCTTGGGG + Intronic
1007384189 6:41509649-41509671 CCTGCAGGCCCTCCTCCCTACGG - Intergenic
1007761199 6:44134680-44134702 CCTGCAGGGCCTGCCCTTTGGGG + Exonic
1008228038 6:48946296-48946318 TCTGGAGATCCTTCTCTTTGCGG - Intergenic
1008984909 6:57530669-57530691 CCTGCAAGTCCTCCTCCTACAGG - Intronic
1009609616 6:65923815-65923837 TCTGCAGGAATTTCTCCTTGGGG - Intergenic
1015384465 6:132606345-132606367 CCCGCTGGTCCTTCTACTTGTGG - Intergenic
1017587917 6:155947243-155947265 CCTGCCGGTGCCTCTCCTTATGG + Intergenic
1019345080 7:525718-525740 CCTCCAGCCCCTTCTCCATGAGG - Intergenic
1019773115 7:2896181-2896203 CTTGCAGCTCCTTTTGCTTGAGG - Intergenic
1020088887 7:5326400-5326422 CCTACAGGCCCTTCTCATCGCGG - Intronic
1020311528 7:6872279-6872301 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1020987582 7:15155983-15156005 ACAGCAGGTGCTTCACCTTGAGG - Intergenic
1021474706 7:21047887-21047909 CCTCCAGGTGCTTCTGATTGGGG - Intergenic
1021623821 7:22573279-22573301 TCTGAAGCTCCATCTCCTTGGGG + Intronic
1022097174 7:27148208-27148230 CCTGAAGGTCCTGCTCCAGGAGG + Intronic
1022113283 7:27244101-27244123 CCTGCAGCTCCTTTTCCTTTGGG - Intronic
1022674597 7:32487265-32487287 ACTTCAGGTCCTTCTCCTCCAGG + Exonic
1023436650 7:40147164-40147186 CCTGCTGGTCCCTCCCCTAGCGG - Intronic
1024987789 7:55210553-55210575 CCTCCAAGTCCATGTCCTTGTGG - Exonic
1025205421 7:56990721-56990743 CCTACAGGCCCTTCTCATCGCGG + Intergenic
1025666519 7:63586218-63586240 CCTACAGGCCCTTCTCATCGCGG - Intergenic
1025992324 7:66505398-66505420 CCAGCAGGTCCTTCTTGTTGAGG + Intergenic
1026581926 7:71625657-71625679 CAAGCAGGTACTTCTCCTTTCGG + Intronic
1028117292 7:87013535-87013557 CCTGCTGGTACTTCTCAATGTGG - Intronic
1028148997 7:87350671-87350693 CATGCTCATCCTTCTCCTTGGGG - Intronic
1029078206 7:97952379-97952401 CCTGCAACTCTCTCTCCTTGGGG + Intergenic
1031315884 7:120257097-120257119 CCTGCAGGCCCATCACCATGTGG - Intergenic
1031407894 7:121407327-121407349 CCTGCAGGACCTTATGCCTGAGG + Intergenic
1032090140 7:128907438-128907460 TCTGCAGGTCCTTATTCTGGAGG + Exonic
1032539095 7:132688414-132688436 CTTGCTGGTCCTTCTGCCTGAGG - Intronic
1032543619 7:132724457-132724479 CCTCCAGCCCCTTCTCCATGTGG + Intronic
1033737581 7:144238728-144238750 CCTGCATGCTCATCTCCTTGGGG + Intergenic
1033745476 7:144312229-144312251 CCTGCATGCTCATCTCCTTGGGG - Intergenic
1034692076 7:153021880-153021902 CCTCCAGGTCCCTGTCCTTAGGG - Intergenic
1035053670 7:156019476-156019498 TCTGCATGGCCTTCTCCTTGGGG + Intergenic
1036239805 8:7072124-7072146 CCTGCACCTCTCTCTCCTTGTGG - Intergenic
1036262072 8:7249030-7249052 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1036304518 8:7590528-7590550 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
1036314111 8:7707569-7707591 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1036355371 8:8038520-8038542 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
1036487435 8:9192311-9192333 CCTGCATGAACTTCTCATTGTGG + Intergenic
1036816637 8:11907493-11907515 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1036903527 8:12689441-12689463 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1037673103 8:21032205-21032227 GCTGCTGTTCATTCTCCTTGGGG - Intergenic
1037841524 8:22248606-22248628 CCTCCATGTCCTCTTCCTTGGGG - Exonic
1038799103 8:30733173-30733195 CCTGCAAATCTCTCTCCTTGTGG - Intronic
1039567379 8:38561028-38561050 TCCGCAGGCCCTTCTCCTGGTGG + Intergenic
1039884448 8:41647195-41647217 CCTGCATGTCTTTCTGCTTCTGG - Exonic
1041030907 8:53734368-53734390 CCTGCATATTTTTCTCCTTGTGG - Intronic
1047857460 8:128927153-128927175 CCTGCAAGCCATTCTGCTTGTGG + Intergenic
1048957398 8:139548339-139548361 CCTGCACATCTCTCTCCTTGTGG + Intergenic
1049104597 8:140603974-140603996 CATGCAGCTCCTTCACCCTGAGG - Intronic
1049196124 8:141316586-141316608 CCTACAGGGCCTCCTCCTAGGGG - Intergenic
1049989932 9:981284-981306 CTTGCAGGTGCTTCTCTTTGGGG - Intronic
1049991966 9:999186-999208 CCTGCCGGTCCTGCGCCGTGGGG - Intergenic
1051104900 9:13568508-13568530 CCTGCAGTTTCCTCTCATTGGGG + Intergenic
1051284267 9:15479590-15479612 CCTGCAGGTCGTCCTCTTTTAGG + Exonic
1052999072 9:34567434-34567456 CCTGCATGTCCTTCTTCTTTAGG - Intronic
1055120939 9:72660024-72660046 CCTGCCTGTCCTTCTCCTTGAGG + Intronic
1055373588 9:75625381-75625403 CTGGCAGGTCCTTCTCAATGAGG + Intergenic
1056207833 9:84337215-84337237 TCTGCCTGTCCTTCTCCTTGAGG + Intronic
1056796307 9:89661009-89661031 CCTTCAGCTTCTTGTCCTTGAGG - Intergenic
1056865819 9:90226628-90226650 CCTGCATCTCTCTCTCCTTGGGG - Intergenic
1056917200 9:90756274-90756296 CCTGCATCTCTCTCTCCTTGGGG + Intergenic
1057889199 9:98855567-98855589 CCTGTAGTTCCATCTGCTTGGGG - Intergenic
1058317055 9:103581313-103581335 CCTGCAGGGCCTACACCATGTGG + Intergenic
1058886378 9:109324451-109324473 CCTCCACCTCCTACTCCTTGGGG - Intergenic
1060015875 9:120085913-120085935 CCAGCTGGTCCCTCTGCTTGGGG + Intergenic
1060939445 9:127535211-127535233 CCTCCAGGGCCTGCTCCGTGAGG - Intronic
1061652385 9:132061264-132061286 CCTGCAGGCCCTGTCCCTTGAGG + Intronic
1062224115 9:135439427-135439449 CCTGCACATCTCTCTCCTTGTGG + Intergenic
1062364966 9:136204090-136204112 CCTGCAGGTCCCTCTCCCTGTGG + Intronic
1062568836 9:137175236-137175258 CCAGCAGCTCCTCCTCCTTCTGG + Exonic
1185909941 X:3971983-3972005 CCTGCACATCTTTCTCCTTGTGG - Intergenic
1189232019 X:39460069-39460091 ACTGCAGCTGCTTCTCCTGGGGG - Intergenic
1190425865 X:50334150-50334172 CCTGCACATCTTTCTCCTTGTGG + Intronic
1191036059 X:56027642-56027664 CCTGGACATCTTTCTCCTTGTGG + Intergenic
1191631808 X:63330295-63330317 CCTGCAGTTCCAGCTACTTGGGG + Intergenic
1192207651 X:69106923-69106945 GCTTCAGGTCCTGCTTCTTGGGG - Intergenic
1193359299 X:80561577-80561599 CCTCCTGGTCCCCCTCCTTGGGG + Intergenic
1193789145 X:85797420-85797442 CCTGGAGGACCTTCTCAGTGAGG + Intergenic
1194400529 X:93434256-93434278 CCTGCACATCTCTCTCCTTGTGG - Intergenic
1195281576 X:103339754-103339776 CCTGCCAGTCCATCTCCCTGGGG - Intergenic
1196569647 X:117250511-117250533 CCTGCAGTTCCAGCTACTTGAGG - Intergenic
1198469657 X:136934548-136934570 CCTGCACATCTGTCTCCTTGTGG + Intergenic
1199127182 X:144137410-144137432 ACATCAGGTCCTTCTCTTTGTGG - Intergenic
1199350366 X:146793848-146793870 CCACCAGGTCCCTCTCATTGTGG - Intergenic
1200394098 X:155973118-155973140 CCTGCACATCTTTCTCCATGTGG + Intergenic
1200709428 Y:6470198-6470220 ACTGCATGACCTTCTCATTGTGG - Intergenic
1200734803 Y:6782692-6782714 CCTGCTGGTCTCTCTCCTAGTGG + Intergenic
1200915312 Y:8566222-8566244 TCTGCATGGCCTTCTCATTGTGG + Intergenic
1200932748 Y:8711854-8711876 TCTGCATGGCCTTCTCATTGTGG - Intergenic
1200937753 Y:8753099-8753121 TCTGCATGACCTTCTCATTGTGG - Intergenic
1200938532 Y:8759363-8759385 GCTGCAGGGCCTTCTCATAGTGG - Intergenic
1200948267 Y:8867212-8867234 CCTGCACATCTCTCTCCTTGCGG - Intergenic
1200984464 Y:9291004-9291026 TCTGCAAGGCCTTCTCATTGTGG - Intergenic
1201024684 Y:9694510-9694532 ACTGCATGACCTTCTCATTGTGG + Intergenic
1201555084 Y:15258830-15258852 CCTGCACATCTTTCTCCTTGTGG - Intergenic
1201792568 Y:17858461-17858483 TCAGCAGGTCCCTCTGCTTGGGG - Intergenic
1201808986 Y:18047525-18047547 TCAGCAGGTCCCTCTGCTTGGGG + Intergenic
1202074541 Y:21025205-21025227 CCACCAGGTACTACTCCTTGAGG - Intergenic
1202130700 Y:21606045-21606067 TCTGCATGGCCTTCTCATTGTGG - Intergenic
1202153031 Y:21860154-21860176 TCTGCAAGCCCTTCTCATTGTGG - Intergenic
1202168207 Y:22014700-22014722 TCTGCTGGTTCTTATCCTTGGGG - Intergenic
1202177261 Y:22109250-22109272 TCTGCATGGCCTTCTCATTGTGG - Intergenic
1202179999 Y:22131570-22131592 TCTGCATGGCCTTCTCATTGTGG - Intergenic
1202182839 Y:22154127-22154149 TCTGCATGGCCTTCTCATTGTGG - Intergenic
1202208520 Y:22432274-22432296 TCTGCATGGCCTTCTCATTGTGG + Intergenic
1202211362 Y:22454824-22454846 TCTGCATGGCCTTCTCATTGTGG + Intergenic
1202214100 Y:22477134-22477156 TCTGCATGGCCTTCTCATTGTGG + Intergenic
1202223154 Y:22571668-22571690 TCTGCTGGTTCTTATCCTTGGGG + Intergenic
1202319961 Y:23623992-23624014 TCTGCTGGTTCTTATCCTTGGGG - Intergenic
1202354104 Y:24027708-24027730 TCAGCAGGTCCCTCTGCTTGGGG - Intergenic
1202516675 Y:25642404-25642426 TCAGCAGGTCCCTCTGCTTGGGG + Intergenic
1202550807 Y:26046064-26046086 TCTGCTGGTTCTTATCCTTGGGG + Intergenic